Date: Thu Jan 4 08:01:58 EST 2007
Name: Email: URL:http:// Remote Host: cache6-e6.mayo.edu
Subject: Dr. Zuker,
I was trying Mfold for the first time yesterday and entered a cDNA sequence from the RefSeq database (in FASTA). I never got an answer. This morning I read that the original Mfold is no longer? Perhaps I submitted to the wrong site. Could you direct me to the correct one. I also have a question. Most mRNA sequences are quite long. What is the maximum your program will accept? I was reading in "Bioinformatics for Dummies" that 3000 bp was the maximum number of nucleotides to submit? Is this true?
Thanks so much.
Linda
M. Zuker replies:
I noticed that you submitted two short sequences to the mfold server on Thursday, January 4, 2007 between 15:00 and 16:00. I assume that you saw the results. The server accepts batch jobs up to 6000 bp. It has done so for several years.
Date: Sun Jan 7 14:11:31 EST 2007
Name: Jonathan Perreault
Email:Jonathan.Perreault@USherbrooke.ca URL:http:// Remote Host: jpp-5408-2
Subject: GU wobble
Dear Dr Zucker,
I have two questions concerning some outputs from Mfold.
First, wobble base pairs: I noticed that some wobble base pairs do not form even if they are in the middle of a stem. It seems to happen with consecutive wobbles (GU followed by UG). Is it known to be impossible to form, or less favorable?
Second, I also noticed that in some cases (in fact, I saw that only once), a "potential" GC base pair at the end (or beginning) of a stem does not form. Is it because Mfold also considers adjacent stems and "judges" there is no room for that base pair?
Thank you and thanks for the very useful software Mfold.
Jonathan Perreault
Date: Sat Jan 27 19:14:35 EST 2007
Name: Rong Mu
Email:murong@nmsu.edu URL:http:// Remote Host: ninet1.nmsu.edu
Subject: Do you still have the RNA mfold version 2.3 server? I hope to get the structure at lower temperature. Thank you!
Date: Wed Feb 14 04:03:36 EST 2007
Name: Ting Wei
Email:t.wei@auckland.ac.nz URL:http:// Remote Host: ip-58-28-147-206.ubs-dsl.xnet.co.nz
Subject: need your help
Dear Dr. Michael Zuker,
First, I should say thank you very much for providing such an exallent software for user freely.
I used Mfold to fold secondary structure of some fragments last year and the figure allowed me to see the nucleotide clearly. But I just tried today but the figure change in another way in which I couldn't see the nucleotide and the number of the length clearly. I need to your help to solve out this problem. Thank you very much again.
Best regards
Ting
Date: Mon Mar 19 07:11:58 EST 2007
Name: Warren Kibbe
Email:wakibbe@northwestern.edu URL:http://www.basic.northwestern.edu/biotools/OligoCalc.html Remote Host: vpn164237.vpn.northwestern.edu
Subject: mfold versus DINAMelt packages
Dear Dr. Zuker;
I would like to include a submission to either your mfold or DINAMelt packages from a rather simplistic Oligo Properties calculator I wrote some time ago. We wrote some very simplistic (unrealistic even) inter-molecular and intramolecular hybridization algorithms, and having learned of your software, I would like to link to the package that you would recommend for this. Looking at the two services, I believe that most of my users would prefer to see the mfold output, particularly the structure plots with the Tms for each predicted structure. My question is then two-fold:
1. Would you mind if I like to your submission page directly?
2. which of the packages that you have written would you recommend for the purpose of showing folding structures? I presume mfold as I could not find an option to output the structures from DINAmelt.
Thank you very much for making such an excellent resource available to the community.
Warren
M. Zuker replies:
By all means link to whatever submission pages you think are
appropriate. The mfold software is for single-stranded RNA or DNA. However, if you link two sequences using 3 Ls, then the
sequence will be treated as a dimer. This is what is called a
"hack". The DINAMelt web server was created to simulate melting
profiles for up to two single-stranded DNA or RNA sequences. It
uses our new UNAFold software that supercedes mfold,
but does not offer "full service folding".
The DINAMelt web server also has simplified submission forms that
allow the user to submit multiple sequences or multiple pairs of
sequences for simple Tm computations. See Two-state Folding and Two-state Hybridization. Both of these
simplified servers use a two-state model to estimate
Tm. Structure plots are available from these sites. The
main DINAMelt site computes melting profiles
using partition function computations at many different
temperatures. Structure output is not appropriate.
Warren
Date: Thu May 31 14:40:34 EDT 2007
Name: Niamh Redmond
Email:n.redmond1@nuigalway,ie URL:http:// Remote Host: proxy1.library.nuigalway.ie
Subject: Need help
Hi Dr. Zuker,
I need some help! I have an SSU rRNA sequence of 1950nt length that I need to fold for a
paper. The majority of the sequence follows the general eukaryote SSU map and I have
used Mfold for the other variable regions so I know the structure of the entire gene but I
am wondering if there is an easier way for Mfold to create the complete secondary
structure model without me having to input all the constraints (as I know I will get this
wrong somehow!). Could I somehow enter the sequence bit by bit then construct the
complete model??
Any help would be greatly appreciated,
Niamh
Date: Mon Jun 11 12:38:12 EDT 2007
Name: kay scheets
Email:kay.scheets@okstate.edu URL:http://lse102-scheets.cas.okstate.edu Remote Host: lse102-scheets.cas.okstate.edu
Subject: PS files missing part of figure
Friday and today I've been folding two RNA sequences with minor variations in one location. On Friday, the PS (and PDF) files showed the entire structure, as expected. Today, .PS and .PDF files have figures that are shown at too large a scale to fit on one page. There is only 1 page in the file, so it shows a truncated figure. The jpg and png files show the whole figure. I use your site quite often and have not had this problem before.
PS. Using the term "translate" with a DNA sequence is more confusing than is necessary to avoid SPAM (most molecular biologist will change that to an amino acid sequence). Perhaps changing it to read "Using R for purine and Y for pyrimidine, change the following DNA sequence to its degenerate sequence" would be less confusing.
M. Zuker replies: The problems with images on the mfold web server will be fixed soon.
I have followed your advice and altered the directions for the simple "test" to avoid spam.
Date: Fri Jul 13 19:04:49 EDT 2007
Name: Ohn Jo Koh
Email:okoh@smu.edu URL:http:// Remote Host: rm126pc2.stat.smu.edu
Subject: hybrid-min - long external loops, open base pair
Dear Dr. Zuker,
I have two questions concerning hybrid-min.
1. With hybrid-min, is there any option I could use to get hybridization results without long external loops?
I was getting different deltaG values depending on the presence of long external loops.
But these long external loops are irrelevant to my situation. The second sequences are about 10 times as long as the first sequences but in reality the second sequences would be chopped up and the actual binding polynucleotide would be about the same length as the first sequence.
2. I ran two-state-hybridization with TCGTGGTTGAACATGTCCCTGCAGT and its reverse complimentary sequence with default parameters. In the result, base pairs at both ends were open. I thought all nucleotides should be paired. Why does this happen? Is this just what it is in nature? Can I force both ends to bind? How can I do that? Again, does doing so make sense?
Thank you,
Ohn Jo Koh M. Zuker replies:
I don't understand what you mean by "long external loops". If you
simulate hybridization between a long sequence, A, and a short one, B,
then hybrid-min will select a region in A that gives the
lowest hybridization free energy. If you run using the "--mfold" flag,
then hybrid-min will (in general) select multiple regions
of A and the result will be different hybridizations. Some may be
variants of each other (same region of A) and some will be totally
different.
Why is this a problem for you? If you know where B binds, then cut out
that portion of A, (call it C) and simulate the hybridization of C
with B. If you don't know where B binds, then the software picks a
best place and/or gives you a few choices (best and several others
whose hybridization free energies are only slightly higher). You can
then rerun hybrid-min using the results of the first run.
There are two ways to simulate 2-state hybridization using the
DINAMelt web server. One is to choose the two state option
here, where you should exclude all other molecular
species (A, B, AA and BB). It is clear that you did not do this,
because this option does not predict actual structures. The other way,
is to use the two-state hybridization seerver that gives quick results for
many pairs of sequences in a single job.
When I ran your sequence, only one end base pair was open. However,
that is not the point. Hybridization is a dynamic equilibrium
process. Hydrogen bonds break and re-form at a high rate. In
particular, there is an equilibrium between base pairing and not
pairing, particularly at the ends. What you see is the result of
energy rules that make it more favorable to open AU base pairs at the
end(s) than to pair them. If you use the full DINAMelt web sever, you
can produce plots that show the probabilities of all possible base
pairs. Note that when our software shows two bases that are not paired
at the end of a helix, it is still adding the favorable stacking
interactions of these two end bases on the adjacent base pair.
Date: Tue Jul 17 00:04:23 EDT 2007
Name: Yara Mejia
Email:yara@berkeley.edu URL:http:// Remote Host: dhcp-128-32-182-31.LIPS.Berkeley.EDU
Subject: The computed foldings contain 3010 base pairs out of 73785 (4.1%) in the energy dot plot
I have been using your server to fold RNA at different temperatures. I would like to know how much of my sequence is in base pairs at the different temperatures. The results show under the title "Computed structures" the phrase "The computed foldings contain 3010 base pairs out of 73785 (4.1%) in the energy dot plot". Is this the information I am after?? How do I interpret this? I am not sure I understand how this was calculated and what this percentage really means. Any information in this regard will be greatly appreciated.
M. Zuker replies:
The energy dot plot is the superposition of all possible
foldings whose free energies are within some user specified increment
from the minimum free energy (mfe). That is a mathematical fact. The
actual sample of foldings that are computed will contain only some of
those base pairs. In general, a high fraction is better. You have to
look at the energy dot plot and judge by eye what regions seem to be
better defined than others. See
M. Zuker &
A. B. Jacobson. Using Reliability Information to Annotate RNA
Secondary Structures. RNA 4, 669-679 (1998).
This provides information on the reliability of (parts of) the various
predicted foldings. It does not answer your question. You need to
compute the expected number of base pairs, and this can be done by
summing the probabilities in the ".plot" output file produced by the
hybrid-ss program from our new UNAFold
package. The same result can be obtained by summing the probabilities
of all base pairs predicted by the Vienna package RNAfold program. (In
this case, you need to select the lines of the output dot plot
PostScript file that specify base pairs and sum the squares of the
last numbers on these lines. This is a hack, but gives a correct
answer.) I plan on implementing partition function computations on a
server at RPI and to offer them in addition to the usual
computations. At this time, you will be able to compute the expected
number of base pairs in the Boltzmann ensemble of all possible
foldings.
Date: Mon Jul 23 15:06:35 EDT 2007
Name: Yvonne Ziegler
Email:yziegler@uiuc.edu URL:http:// Remote Host: butch.life.uiuc.edu
Subject: predicting structure for long/distal regions
Hello, Dr. Zuker,
I would like to do some secondary structure analysis of a lengthy DNA sequence, about 350,000 base pairs. This is based on results of chromosome capture experiments, which show a promoter affiliating with sequences about 50,000bp, 168,000bp, 205,000bp, 306,000bp, and 311,000bp upstream of where the polymerase is shown to bind. BAC clone controls show that the DNA has some related structure even in the absence of proteins and cross linking agents. Is there software available for such a large input?
Thanks!
Yvonne Ziegler
Date: Tue Jul 24 10:02:29 EDT 2007
Name: fazel
Email:akesh081@uottawa.ca URL:http:// Remote Host: 137.122.200.14
Subject: ct format
Dear Prof. Zuker,
1-I'd like to enter "ct" format instead of sequence format.
How I can do that?
2- Does mflod able to compare to sequence or ct: in term of how many based-pair formed in 2 sequences?
Thank you
Fazel
Date: Fri Jul 27 07:02:56 EDT 2007
Name: verlaeten
Email:verlaeten@gmail.com URL:http:// Remote Host: user.fsagx.ac.be
Subject: Mfold for Primer location on DNA target
Hello,
I am a new user of Mfold and I would like to use it in order to predict the secondary structure of my PCR cDNA target and, of course, avoid to pick my primer around an area with such a structures. So, I would like to know the difference between the folding temperature, which can be modified along with the salting parametres (is it the annealing temperature for my primer annealing ?), and the Tm indicated into the Loop Free-Energy Decomposition windows ?
in concrete terms, If i want to know the secondary structure of my target cDNA at 60°c, do I have to enter 60 for the folding temperature and do not consider the Loop Free-Energy Decomposition Tm value ??
Thank you for your answer
olivier verlaeten, Ph.D
Biological molecular Lab
FUSAGx
Belgium Date: Thu Sep 6 07:17:31 EDT 2007
Name: Priyanka Sharma
Email:contactpriyanka16@gmail.com URL:http:// Remote Host: 203.129.208.203
Subject: RNA 3D structure
Dear Sir,
I have been using your software for the RNA secondary structure prediction for my resaerch.In future I shall be requiring the 3D structure information for the RNA for "Protein - RNA interaction study".My research work partly involves the conversion of RNA 2D structure into RNA 3D structure.
Therefore I shall be much obliged to you if you could please give me the information regarding the softwares which converts the RNA 2D strcture into RNA 3D structure from your database.
Yours sincerely,
Priyanka Sharma
Research Scholar
Deptt. of Bioinformatics & Biotechnology
Jaypee Univ. of Information & Tech.
New Delhi
India
Date: Wed Oct 24 12:30:29 EDT 2007
Name: Niamh Redmond
Email:n.redmond1@nuigalway,ie URL:http://ru-t.com Remote Host: 217.151.231.18
Subject: Need help
Hi Dr. Zuker,
I need some help! I have an SSU rRNA sequence of 1950nt length that I need to fold for a
paper. The majority of the sequence follows the general eukaryote SSU map and I have
used Mfold for the other variable regions so I know the structure of the entire gene but I
am wondering if there is an easier way for Mfold to create the complete secondary
structure model without me having to input all the constraints (as I know I will get this
wrong somehow!). Could I somehow enter the sequence bit by bit then construct the
complete model??
Any help would be greatly appreciated,
Niamh
Date: Sat Nov 17 22:18:47 EST 2007
Name: Paul Shapshak, PhD
Email:pshapsha@health.usf.edu URL:http:// Remote Host: pool-71-100-53-240.tampfl.dsl-w.verizon.net
Subject: PDF print outs
I am unable to print out the final folding image in the PDF files so the letters and numbers are visible
should I start the folding request over again and request the larger fonts?
---Paul Shapshak, PhD Date: Mon Dec 3 11:01:22 EST 2007
Name: Mong Ru
Email:murong@nmsu.edu URL:http://adsensical-adsense.blogspot.com/ Remote Host: 195.95.184.10
Subject: adsense blog
Do you still have the RNA mfold version 2.3 adsense blog server? I hope to get the structure at lower temperature. Thank you!
Date: Tue Jan 8 04:51:29 EST 2008
Name: George Gereb
Email:gy.gereb@gmail.com URL:http://www.wpchimp.com Remote Host: 82-77-99-194.cable-modem.hdsnet.hu
Subject: flash application
Hi, I'm a digital artist. I'm experienced in flash and 2d-3d animation. I know very little about dna and cells, but it would be a great experience for me to be assistance in the creation of some kind of visualization tool. I dont know if this is the right place to ask, but if anybody has an idea either of some kind of explanatory animation or small application to visualize something I would be happy to help.
(and the spam is fillter ISN'T simple at all)
Date: Mon Jan 14 05:57:30 EST 2008
Name: Angeline Van Hoef
Email:angelinevanhoef@kpnplanet.nl URL:http:// Remote Host: kokosnoot.wur.nl
Subject: unrecognised compementairy bases
I have analysed a sequence for secundairy structures. a hairpin structure is found with a stem of 3 bases (nr. 77-89, 78-88, 79-89) long, however upon visual inspection the stem should be 4 bases (also; 76-90) long as the adjacent bases at the start and end of the structure are also complementairy (C-G). Why is this not found in calculation. The calculation is 08Jan14-05-30-00 at 65° C. (3.2) with standard conditions except for: [Na+] = 0.025 M, [Mg++] = 0.01 M, oligo correction.
M. Zuker replies:
At 65° C, the final base pair has a probability of less than 50% of forming. It would be predicted at lower temperatures. Using the DINAMelt web server, you can compute exact base pair probabilities. The probability of the final base pair is 27%. The probabilities of the adjacent four base pairs are 57%, 59%, 57% and 40%, respectively. Even when the final C-G base pair does not form, the stacking of the C and G on the adjacent base pair is being considered. It helps to stabilize the stem.
Date: Wed Feb 6 21:44:26 EST 2008
Name: Pierre
Email:plesimple@contact.fr URL:http:// Remote Host: modemcable046.208-56-74.mc.videotron.ca
Subject: Interrupted treatment
Maybe adding an option for the program to begin backfrom a previous output would be good... I know, it's pure lazyness from my part, but ensuring that no file with a confusing name is present in the current folder, and/or that all the relevant files are actually in the current folder can be quite a hassle... (and time-consuming too, I mean, moving and removing all these files around when doing several calculations in parallel). Something like "--continue=$PATH-TO-FOLDER" would be good, allowing to keep the sequences and temporary files in separate folders.
(sorry if it is already implemented and I missed it in the doc. Sorry also for sucking so bad at Perl, I would have implemented that myself if I was better!)
Date: Wed Feb 6 21:48:38 EST 2008
Name: Pierre
Email:see up URL:http:// Remote Host: modemcable046.208-56-74.mc.videotron.ca
Subject: Almost forgot...
I almost forgot to say that UNAFold (and the associated utilities) are great work. Very useful too. Thanks and congratulations! Date: Sat Feb 23 16:53:28 EST 2008
Name: Jason Vertrees
Email:javertre@utmb.edu URL:http:// Remote Host: powerbar.cs.dartmouth.edu
Subject: Great job!
Just thought I'd drop a line to say nice job. Many bio-servers now require all sorts of information from the user and don't allow batch processing. Kudos to you guys for good utility!
-- J
Date: Mon Feb 25 14:03:04 EST 2008
Name: Michael Zuker
Email:zukerm@hotmail.com URL:http:// Remote Host: unafold.math.rpi.edu
Subject: testing
Just a test.
Date: Tue Mar 4 01:20:40 EST 2008
Name: Jason
Email:jason.corneveaux@asu.edu URL:http:// Remote Host: ip70-162-216-239.ph.ph.cox.net
Subject: Its not working!!
Looks like my functional genomics class crashed your server. Sucks, this is due tomorrow. I tried your mirror, but its going to take 13 hours and my assignment is due in less time than that. BLARG!!!
Date: Wed Mar 5 18:09:17 EST 2008
Name: Brian Hanley
Email:bphanley@ucdavis.edu URL:http:// Remote Host: 128.120.52.69
Subject: Nice
Nice. Would be great to do 3D plots. PDB for instance. It would be amazing to have probability animations.
Date: Thu Mar 20 17:11:48 EDT 2008
Name: Xin Hong
Email:xinhong@indiana.edu URL:http:// Remote Host: 156-56-15-152.dhcp-bl.indiana.edu
Subject: A question about converting format
Hello there,
I work as bioinformatics consultant at Indiana University. I got a user's request that I think you may know more.
Any information is appreciated.
Xin
Inc:
I am seeking a converter utility that will allow me to convert a bracket
(Vienna) notation RNA structure file over to ct (Zucker) notation, since most visualization software seems to prefer Zucker notation over bracket, while most analysis software prefers Vienna notation. Is there anything like this on one of our machines?
Thank you.
Bryan Maloney M. Zuker replies:
The name is "Zuker", not "Zucker". I didn't invent the ct notation. Our new UNAFold software has extended the format of the ct file to contain information on single base stacking.
To convert from Vienna "b" notation to the "ct" notation, I offer you my Perl script, b2ct.pl. Usage is: b2ct < name.b > name.ct
Date: Fri Apr 18 12:11:44 EDT 2008
Name: Valley Stewart
Email:vjstewart@ucdavis.edu URL:http:// Remote Host: ucdavis.edu
Subject: Thanks for mfold
I greatly appreciate mfold being available as a web server. It is very easy to use, and gives
virtually instant feedback. It is extremely useful for my research.
Sincerely,
Valley Stewart
Professor of Microbiology
University of California, Davis
Date: Tue Apr 22 11:28:24 EDT 2008
Name: Martin
Email:martin.brenndoerfer@lrz.uni-muenchen.de URL:http:// Remote Host: boshart8.gi.biologie.uni-muenchen.de
Subject: Colors in RNA structures
what is behind the red and blue colors of the dots in the RNA structures?
M. Zuker replies: The answer is "absolutely nothing". The colors are arbitrary and are used to make the output more attractive and to distinguish among the different kinds of base pairs.
Date: Thu Apr 24 05:37:18 EDT 2008
Name: Wutto
Email:larukuka@hotmail.com URL:http:// Remote Host: 203.185.133.132
Subject: I have a question
Dear Dr. Michael Zuker,
First at all, I would like to thank you for providing the exallent software for user freely.
I have some problem about the MFE(Minimal Folding Free Energy) and
MFEI(Minimal Folding Free Energy Index).
I would like to known which output file contains those two parameters.
M. Zuker replies: I have absolutely no idea what "MFEI" is. I have never before seen the term "Minimal Folding Free Energy Index"? Where did you see it?
Date: Mon May 19 09:08:34 EDT 2008
Name: Mary
Email:mary.adams1c@hotmail.com URL:http://dvd-blueray.com/ Remote Host: p54BCAA0E.dip0.t-ipconnect.de
Subject: Thought DNA is made of Adenin Thymin Guanin and Cytosin... don't know what R and Y means!? M. Zuker replies: R is for puRine and Y is for pYrimidine.
Date: Thu May 29 19:38:08 EDT 2008
Name: Genievive
Email:g_delmundo@hotmail.com URL:http:// Remote Host: hotmail.com
Subject: Secondary Structures
Hi Dr. Zuker,
I inputed my RNA sequence in your server and it generated 29 different structures. I need to know where the stems and loops are so I can weight them to build my phylogenetic trees. I was wondering how do I know which is the best tree. I know that they were folded with different temperatures. I looked in the manual and it doesn't tell me which structure would be best.
Your help will be most grateful
Cheers,
Genievive
Date: Sat Jun 21 18:02:30 EDT 2008
Name: ingilizce sözlük
Email:szlk@webirmen.com URL:http://www.webirmen.com Remote Host: 78.162.207.102
Subject: Thank
Wonderful. Thank you very much for you prompt and very informative response.
Date: Tue Jun 24 07:31:30 EDT 2008
Name: Geert Vandeweyer
Email:geert.vandeweyer2@ua.ac.be URL:http:// Remote Host: 143.169.15.157
Subject: bypassing binaries
hi,
I'm using your unafold scripts on a rather large scale screening, and I was wondering if I can rewrite the following commands to directly access the perl scripts, to see if it is faster (I'm using a local install, accessing the binaries from a perlscript with `command` syntax):
hybrid-ss-min -q --NA=DNA "$SEQUENCE"
hybrid-min -q -NA=DNA "$SEQUENCE1" "$SEQUENCE2"
Best Regards,
Geert
Date: Tue Jul 1 12:21:06 EDT 2008
Name: Manjula Devi
Email:mkolipak@hunter.cuny.edu URL:http:// Remote Host: NLGLAB-08
Subject: Biochemistry
tHANK YOU VERY MUCH
¤
Name:
Email:
URL: http://
Remote Host: cache6-e6.mayo.edu
Subject:
Dr. Zuker,
I was trying Mfold for the first time yesterday and entered a cDNA sequence from the RefSeq database (in FASTA). I never got an answer. This morning I read that the original Mfold is no longer? Perhaps I submitted to the wrong site. Could you direct me to the correct one. I also have a question. Most mRNA sequences are quite long. What is the maximum your program will accept? I was reading in "Bioinformatics for Dummies" that 3000 bp was the maximum number of nucleotides to submit? Is this true?
Thanks so much.
Linda
M. Zuker replies: I noticed that you submitted two short sequences to the
mfoldserver on Thursday, January 4, 2007 between 15:00 and 16:00. I assume that you saw the results.The server accepts batch jobs up to 6000 bp. It has done so for several years.
Name: Jonathan Perreault
Email: Jonathan.Perreault@USherbrooke.ca
URL: http://
Remote Host: jpp-5408-2
Subject: GU wobble
Dear Dr Zucker,
I have two questions concerning some outputs from Mfold.
First, wobble base pairs: I noticed that some wobble base pairs do not form even if they are in the middle of a stem. It seems to happen with consecutive wobbles (GU followed by UG). Is it known to be impossible to form, or less favorable?
Second, I also noticed that in some cases (in fact, I saw that only once), a "potential" GC base pair at the end (or beginning) of a stem does not form. Is it because Mfold also considers adjacent stems and "judges" there is no room for that base pair?
Thank you and thanks for the very useful software Mfold.
Jonathan Perreault
Name: Rong Mu
Email: murong@nmsu.edu
URL: http://
Remote Host: ninet1.nmsu.edu
Subject:
Do you still have the RNA mfold version 2.3 server? I hope to get the structure at lower temperature. Thank you!
Name: Ting Wei
Email: t.wei@auckland.ac.nz
URL: http://
Remote Host: ip-58-28-147-206.ubs-dsl.xnet.co.nz
Subject: need your help
Dear Dr. Michael Zuker,
First, I should say thank you very much for providing such an exallent software for user freely.
I used Mfold to fold secondary structure of some fragments last year and the figure allowed me to see the nucleotide clearly. But I just tried today but the figure change in another way in which I couldn't see the nucleotide and the number of the length clearly. I need to your help to solve out this problem. Thank you very much again.
Best regards
Ting
Name: Warren Kibbe
Email: wakibbe@northwestern.edu
URL: http://www.basic.northwestern.edu/biotools/OligoCalc.html
Remote Host: vpn164237.vpn.northwestern.edu
Subject: mfold versus DINAMelt packages
Dear Dr. Zuker;
I would like to include a submission to either your mfold or DINAMelt packages from a rather simplistic Oligo Properties calculator I wrote some time ago. We wrote some very simplistic (unrealistic even) inter-molecular and intramolecular hybridization algorithms, and having learned of your software, I would like to link to the package that you would recommend for this. Looking at the two services, I believe that most of my users would prefer to see the mfold output, particularly the structure plots with the Tms for each predicted structure. My question is then two-fold:
1. Would you mind if I like to your submission page directly?
2. which of the packages that you have written would you recommend for the purpose of showing folding structures? I presume mfold as I could not find an option to output the structures from DINAmelt.
Thank you very much for making such an excellent resource available to the community.
Warren
M. Zuker replies:
mfoldsoftware is for single-stranded RNA or DNA. However, if you link two sequences using 3 Ls, then the sequence will be treated as a dimer. This is what is called a "hack". The DINAMelt web server was created to simulate melting profiles for up to two single-stranded DNA or RNA sequences. It uses our new UNAFold software that supercedesmfold, but does not offer "full service folding".Name: Warren Kibbe
Email: wakibbe@northwestern.edu
URL: http://www.basic.northwestern.edu/biotools/oligocalc.html
Remote Host: vpn161145.vpn.northwestern.edu
Subject: mfold versus DINAMelt packages
Wonderful. Thank you very much for you prompt and very informative response.
Warren
Name: Niamh Redmond
Email: n.redmond1@nuigalway,ie
URL: http://
Remote Host: proxy1.library.nuigalway.ie
Subject: Need help
Hi Dr. Zuker,
I need some help! I have an SSU rRNA sequence of 1950nt length that I need to fold for a
paper. The majority of the sequence follows the general eukaryote SSU map and I have
used Mfold for the other variable regions so I know the structure of the entire gene but I
am wondering if there is an easier way for Mfold to create the complete secondary
structure model without me having to input all the constraints (as I know I will get this
wrong somehow!). Could I somehow enter the sequence bit by bit then construct the
complete model??
Any help would be greatly appreciated,
Niamh
Name: kay scheets
Email: kay.scheets@okstate.edu
URL: http://lse102-scheets.cas.okstate.edu
Remote Host: lse102-scheets.cas.okstate.edu
Subject: PS files missing part of figure
Friday and today I've been folding two RNA sequences with minor variations in one location. On Friday, the PS (and PDF) files showed the entire structure, as expected. Today, .PS and .PDF files have figures that are shown at too large a scale to fit on one page. There is only 1 page in the file, so it shows a truncated figure. The jpg and png files show the whole figure. I use your site quite often and have not had this problem before.
PS. Using the term "translate" with a DNA sequence is more confusing than is necessary to avoid SPAM (most molecular biologist will change that to an amino acid sequence). Perhaps changing it to read "Using R for purine and Y for pyrimidine, change the following DNA sequence to its degenerate sequence" would be less confusing.
M. Zuker replies: The problems with images on the
mfoldweb server will be fixed soon.I have followed your advice and altered the directions for the simple "test" to avoid spam.
Name: Ohn Jo Koh
Email: okoh@smu.edu
URL: http://
Remote Host: rm126pc2.stat.smu.edu
Subject: hybrid-min - long external loops, open base pair
Dear Dr. Zuker,
I have two questions concerning hybrid-min.
1. With hybrid-min, is there any option I could use to get hybridization results without long external loops?
I was getting different deltaG values depending on the presence of long external loops.
But these long external loops are irrelevant to my situation. The second sequences are about 10 times as long as the first sequences but in reality the second sequences would be chopped up and the actual binding polynucleotide would be about the same length as the first sequence.
2. I ran two-state-hybridization with TCGTGGTTGAACATGTCCCTGCAGT and its reverse complimentary sequence with default parameters. In the result, base pairs at both ends were open. I thought all nucleotides should be paired. Why does this happen? Is this just what it is in nature? Can I force both ends to bind? How can I do that? Again, does doing so make sense?
Thank you,
Ohn Jo Koh
M. Zuker replies: I don't understand what you mean by "long external loops". If you simulate hybridization between a long sequence, A, and a short one, B, then
hybrid-minwill select a region in A that gives the lowest hybridization free energy. If you run using the "--mfold" flag, thenhybrid-minwill (in general) select multiple regions of A and the result will be different hybridizations. Some may be variants of each other (same region of A) and some will be totally different.Why is this a problem for you? If you know where B binds, then cut out that portion of A, (call it C) and simulate the hybridization of C with B. If you don't know where B binds, then the software picks a best place and/or gives you a few choices (best and several others whose hybridization free energies are only slightly higher). You can then rerun
hybrid-minusing the results of the first run.There are two ways to simulate 2-state hybridization using the DINAMelt web server. One is to choose the two state option here, where you should exclude all other molecular species (A, B, AA and BB). It is clear that you did not do this, because this option does not predict actual structures. The other way, is to use the two-state hybridization seerver that gives quick results for many pairs of sequences in a single job.
When I ran your sequence, only one end base pair was open. However, that is not the point. Hybridization is a dynamic equilibrium process. Hydrogen bonds break and re-form at a high rate. In particular, there is an equilibrium between base pairing and not pairing, particularly at the ends. What you see is the result of energy rules that make it more favorable to open AU base pairs at the end(s) than to pair them. If you use the full DINAMelt web sever, you can produce plots that show the probabilities of all possible base pairs. Note that when our software shows two bases that are not paired at the end of a helix, it is still adding the favorable stacking interactions of these two end bases on the adjacent base pair.
Name: Yara Mejia
Email: yara@berkeley.edu
URL: http://
Remote Host: dhcp-128-32-182-31.LIPS.Berkeley.EDU
Subject: The computed foldings contain 3010 base pairs out of 73785 (4.1%) in the energy dot plot
I have been using your server to fold RNA at different temperatures. I would like to know how much of my sequence is in base pairs at the different temperatures. The results show under the title "Computed structures" the phrase "The computed foldings contain 3010 base pairs out of 73785 (4.1%) in the energy dot plot". Is this the information I am after?? How do I interpret this? I am not sure I understand how this was calculated and what this percentage really means. Any information in this regard will be greatly appreciated.
M. Zuker replies: The energy dot plot is the superposition of all possible foldings whose free energies are within some user specified increment from the minimum free energy (mfe). That is a mathematical fact. The actual sample of foldings that are computed will contain only some of those base pairs. In general, a high fraction is better. You have to look at the energy dot plot and judge by eye what regions seem to be better defined than others. See
M. Zuker & A. B. Jacobson. Using Reliability Information to Annotate RNA Secondary Structures. RNA 4, 669-679 (1998).
This provides information on the reliability of (parts of) the various predicted foldings. It does not answer your question. You need to compute the expected number of base pairs, and this can be done by summing the probabilities in the ".plot" output file produced by the
hybrid-ssprogram from our new UNAFold package. The same result can be obtained by summing the probabilities of all base pairs predicted by the Vienna package RNAfold program. (In this case, you need to select the lines of the output dot plot PostScript file that specify base pairs and sum the squares of the last numbers on these lines. This is a hack, but gives a correct answer.) I plan on implementing partition function computations on a server at RPI and to offer them in addition to the usual computations. At this time, you will be able to compute the expected number of base pairs in the Boltzmann ensemble of all possible foldings.Name: Yvonne Ziegler
Email: yziegler@uiuc.edu
URL: http://
Remote Host: butch.life.uiuc.edu
Subject: predicting structure for long/distal regions
Hello, Dr. Zuker,
I would like to do some secondary structure analysis of a lengthy DNA sequence, about 350,000 base pairs. This is based on results of chromosome capture experiments, which show a promoter affiliating with sequences about 50,000bp, 168,000bp, 205,000bp, 306,000bp, and 311,000bp upstream of where the polymerase is shown to bind. BAC clone controls show that the DNA has some related structure even in the absence of proteins and cross linking agents. Is there software available for such a large input?
Thanks!
Yvonne Ziegler
Name: fazel
Email: akesh081@uottawa.ca
URL: http://
Remote Host: 137.122.200.14
Subject: ct format
Dear Prof. Zuker,
1-I'd like to enter "ct" format instead of sequence format.
How I can do that?
2- Does mflod able to compare to sequence or ct: in term of how many based-pair formed in 2 sequences?
Thank you
Fazel
Name: verlaeten
Email: verlaeten@gmail.com
URL: http://
Remote Host: user.fsagx.ac.be
Subject: Mfold for Primer location on DNA target
Hello,
I am a new user of Mfold and I would like to use it in order to predict the secondary structure of my PCR cDNA target and, of course, avoid to pick my primer around an area with such a structures. So, I would like to know the difference between the folding temperature, which can be modified along with the salting parametres (is it the annealing temperature for my primer annealing ?), and the Tm indicated into the Loop Free-Energy Decomposition windows ?
in concrete terms, If i want to know the secondary structure of my target cDNA at 60°c, do I have to enter 60 for the folding temperature and do not consider the Loop Free-Energy Decomposition Tm value ??
Thank you for your answer
olivier verlaeten, Ph.D
Biological molecular Lab
FUSAGx
Belgium
Name: Priyanka Sharma
Email: contactpriyanka16@gmail.com
URL: http://
Remote Host: 203.129.208.203
Subject: RNA 3D structure
Dear Sir,
I have been using your software for the RNA secondary structure prediction for my resaerch.In future I shall be requiring the 3D structure information for the RNA for "Protein - RNA interaction study".My research work partly involves the conversion of RNA 2D structure into RNA 3D structure.
Therefore I shall be much obliged to you if you could please give me the information regarding the softwares which converts the RNA 2D strcture into RNA 3D structure from your database.
Yours sincerely,
Priyanka Sharma
Research Scholar
Deptt. of Bioinformatics & Biotechnology
Jaypee Univ. of Information & Tech.
New Delhi
India
Name: Niamh Redmond
Email: n.redmond1@nuigalway,ie
URL: http://ru-t.com
Remote Host: 217.151.231.18
Subject: Need help
Hi Dr. Zuker,
I need some help! I have an SSU rRNA sequence of 1950nt length that I need to fold for a
paper. The majority of the sequence follows the general eukaryote SSU map and I have
used Mfold for the other variable regions so I know the structure of the entire gene but I
am wondering if there is an easier way for Mfold to create the complete secondary
structure model without me having to input all the constraints (as I know I will get this
wrong somehow!). Could I somehow enter the sequence bit by bit then construct the
complete model??
Any help would be greatly appreciated,
Niamh
Name: Paul Shapshak, PhD
Email: pshapsha@health.usf.edu
URL: http://
Remote Host: pool-71-100-53-240.tampfl.dsl-w.verizon.net
Subject: PDF print outs
I am unable to print out the final folding image in the PDF files so the letters and numbers are visible
should I start the folding request over again and request the larger fonts?
---Paul Shapshak, PhD
Name: Mong Ru
Email: murong@nmsu.edu
URL: http://adsensical-adsense.blogspot.com/
Remote Host: 195.95.184.10
Subject: adsense blog
Do you still have the RNA mfold version 2.3 adsense blog server? I hope to get the structure at lower temperature. Thank you!
Name: George Gereb
Email: gy.gereb@gmail.com
URL: http://www.wpchimp.com
Remote Host: 82-77-99-194.cable-modem.hdsnet.hu
Subject: flash application
Hi, I'm a digital artist. I'm experienced in flash and 2d-3d animation. I know very little about dna and cells, but it would be a great experience for me to be assistance in the creation of some kind of visualization tool. I dont know if this is the right place to ask, but if anybody has an idea either of some kind of explanatory animation or small application to visualize something I would be happy to help.
(and the spam is fillter ISN'T simple at all)
Name: Angeline Van Hoef
Email: angelinevanhoef@kpnplanet.nl
URL: http://
Remote Host: kokosnoot.wur.nl
Subject: unrecognised compementairy bases
I have analysed a sequence for secundairy structures. a hairpin structure is found with a stem of 3 bases (nr. 77-89, 78-88, 79-89) long, however upon visual inspection the stem should be 4 bases (also; 76-90) long as the adjacent bases at the start and end of the structure are also complementairy (C-G). Why is this not found in calculation. The calculation is 08Jan14-05-30-00 at 65° C. (3.2) with standard conditions except for: [Na+] = 0.025 M, [Mg++] = 0.01 M, oligo correction.
M. Zuker replies: At 65° C, the final base pair has a probability of less than 50% of forming. It would be predicted at lower temperatures. Using the DINAMelt web server, you can compute exact base pair probabilities. The probability of the final base pair is 27%. The probabilities of the adjacent four base pairs are 57%, 59%, 57% and 40%, respectively. Even when the final C-G base pair does not form, the stacking of the C and G on the adjacent base pair is being considered. It helps to stabilize the stem.
Name: Pierre
Email: plesimple@contact.fr
URL: http://
Remote Host: modemcable046.208-56-74.mc.videotron.ca
Subject: Interrupted treatment
Maybe adding an option for the program to begin backfrom a previous output would be good... I know, it's pure lazyness from my part, but ensuring that no file with a confusing name is present in the current folder, and/or that all the relevant files are actually in the current folder can be quite a hassle... (and time-consuming too, I mean, moving and removing all these files around when doing several calculations in parallel). Something like "--continue=$PATH-TO-FOLDER" would be good, allowing to keep the sequences and temporary files in separate folders.
(sorry if it is already implemented and I missed it in the doc. Sorry also for sucking so bad at Perl, I would have implemented that myself if I was better!)
Name: Pierre
Email: see up
URL: http://
Remote Host: modemcable046.208-56-74.mc.videotron.ca
Subject: Almost forgot...
I almost forgot to say that UNAFold (and the associated utilities) are great work. Very useful too. Thanks and congratulations!
Name: Jason Vertrees
Email: javertre@utmb.edu
URL: http://
Remote Host: powerbar.cs.dartmouth.edu
Subject: Great job!
Just thought I'd drop a line to say nice job. Many bio-servers now require all sorts of information from the user and don't allow batch processing. Kudos to you guys for good utility!
-- J
Name: Michael Zuker
Email: zukerm@hotmail.com
URL: http://
Remote Host: unafold.math.rpi.edu
Subject: testing
Just a test.
Name: Jason
Email: jason.corneveaux@asu.edu
URL: http://
Remote Host: ip70-162-216-239.ph.ph.cox.net
Subject: Its not working!!
Looks like my functional genomics class crashed your server. Sucks, this is due tomorrow. I tried your mirror, but its going to take 13 hours and my assignment is due in less time than that. BLARG!!!
Name: Brian Hanley
Email: bphanley@ucdavis.edu
URL: http://
Remote Host: 128.120.52.69
Subject: Nice
Nice. Would be great to do 3D plots. PDB for instance. It would be amazing to have probability animations.
Name: Xin Hong
Email: xinhong@indiana.edu
URL: http://
Remote Host: 156-56-15-152.dhcp-bl.indiana.edu
Subject: A question about converting format
Hello there,
I work as bioinformatics consultant at Indiana University. I got a user's request that I think you may know more.
Any information is appreciated.
Xin
Inc:
I am seeking a converter utility that will allow me to convert a bracket
(Vienna) notation RNA structure file over to ct (Zucker) notation, since most visualization software seems to prefer Zucker notation over bracket, while most analysis software prefers Vienna notation. Is there anything like this on one of our machines?
Thank you.
Bryan Maloney
M. Zuker replies: The name is "Zuker", not "Zucker". I didn't invent the ct notation. Our new UNAFold software has extended the format of the ct file to contain information on single base stacking.
To convert from Vienna "b" notation to the "ct" notation, I offer you my Perl script, b2ct.pl. Usage is: b2ct < name.b > name.ct
Name: Valley Stewart
Email: vjstewart@ucdavis.edu
URL: http://
Remote Host: ucdavis.edu
Subject: Thanks for mfold
I greatly appreciate mfold being available as a web server. It is very easy to use, and gives
virtually instant feedback. It is extremely useful for my research.
Sincerely,
Valley Stewart
Professor of Microbiology
University of California, Davis
Name: Martin
Email: martin.brenndoerfer@lrz.uni-muenchen.de
URL: http://
Remote Host: boshart8.gi.biologie.uni-muenchen.de
Subject: Colors in RNA structures
what is behind the red and blue colors of the dots in the RNA structures?
M. Zuker replies: The answer is "absolutely nothing". The colors are arbitrary and are used to make the output more attractive and to distinguish among the different kinds of base pairs.
Name: Wutto
Email: larukuka@hotmail.com
URL: http://
Remote Host: 203.185.133.132
Subject: I have a question
Dear Dr. Michael Zuker,
First at all, I would like to thank you for providing the exallent software for user freely.
I have some problem about the MFE(Minimal Folding Free Energy) and
MFEI(Minimal Folding Free Energy Index).
I would like to known which output file contains those two parameters.
M. Zuker replies: I have absolutely no idea what "MFEI" is. I have never before seen the term "Minimal Folding Free Energy Index"? Where did you see it?
Name: Mary
Email: mary.adams1c@hotmail.com
URL: http://dvd-blueray.com/
Remote Host: p54BCAA0E.dip0.t-ipconnect.de
Subject:
Thought DNA is made of Adenin Thymin Guanin and Cytosin... don't know what R and Y means!?
M. Zuker replies: R is for puRine and Y is for pYrimidine.
Name: Genievive
Email: g_delmundo@hotmail.com
URL: http://
Remote Host: hotmail.com
Subject: Secondary Structures
Hi Dr. Zuker,
I inputed my RNA sequence in your server and it generated 29 different structures. I need to know where the stems and loops are so I can weight them to build my phylogenetic trees. I was wondering how do I know which is the best tree. I know that they were folded with different temperatures. I looked in the manual and it doesn't tell me which structure would be best.
Your help will be most grateful
Cheers,
Genievive
Name: ingilizce sözlük
Email: szlk@webirmen.com
URL: http://www.webirmen.com
Remote Host: 78.162.207.102
Subject: Thank
Wonderful. Thank you very much for you prompt and very informative response.
Name: Geert Vandeweyer
Email: geert.vandeweyer2@ua.ac.be
URL: http://
Remote Host: 143.169.15.157
Subject: bypassing binaries
hi,
I'm using your unafold scripts on a rather large scale screening, and I was wondering if I can rewrite the following commands to directly access the perl scripts, to see if it is faster (I'm using a local install, accessing the binaries from a perlscript with `command` syntax):
hybrid-ss-min -q --NA=DNA "$SEQUENCE"
hybrid-min -q -NA=DNA "$SEQUENCE1" "$SEQUENCE2"
Best Regards,
Geert
Name: Manjula Devi
Email: mkolipak@hunter.cuny.edu
URL: http://
Remote Host: NLGLAB-08
Subject: Biochemistry
tHANK YOU VERY MUCH
¤