Date: Wed Jan 4 22:37:20 EST 2006
Name: Jing Zhang
Email:zhangjing@hrbeu.edu.cn URL:http:// Remote Host: 218.7.43.222
Subject: apply for postdoctor position
Can I apply for postdoctor in your place?
Date: Thu Jan 5 07:17:47 EST 2006
Name: Agnieszka
Email:tango@man.poznan.pl URL:http:// Remote Host: dcs-rp.cs.put.poznan.pl
Subject: length of sequence - still problem
Dear Dr. Zuker,
I've similar problem to Trina (explained by her above).
When I run a sequence through mfold from a
command line on my local installation, it does not use all nucleotides from my sequence, but only part of them (e.g. 225 instead of 260). There is no such problem when using mfold through web interface.
I tried your solution with assuring that each line contains no more than 80 nucleotides, but it didn't help.
Do you have any idea what is happening? I would be very grateful for any help. I'm looking forward to hearing from you.
best regards,
Agnieszka M. Zuker replies:
mfold version 3.2 has a script named reformat-seq.sh that solves the long line problem. The first version introduced a bug that truncated the sequence! This was fixed on December 10, 2005. Any download of mfold-3.2 after this date will not have this error. The version of reformat-seq.sh obtained by following the above hyper-link is correct.
Date: Thu Jan 5 10:21:07 EST 2006
Name: ElsV
Email:els.vanbleu@telenet.be URL:http:// Remote Host: 213.193.133.122
Subject: Vienna output format
Dear Dr. Zuker,
I was wondering if any one has ever tried to parse the output automatically from Mfold in any way (e.g. by using perl)?
Date: Tue Jan 10 03:36:46 EST 2006
Name: HESLOT Francois
Email:heslot@lpa.ens.fr URL:http:// Remote Host: fh-02.lpa.ens.fr
Subject: impossible to get results from batch folding
Dear Sir,
I used the Mfold server (that I appreciate a lot), to get 4 long sequences folded, using the batch option (logged on friday jan 6th).
This morning (1-10-2006), I received the e-mail notifications of the results, from no_reply@bioinfo.rpi.edu. All the links transmitted have problems. Here is one of mail received:
"The folding of oxa _7 inverse aaa_1_ is completed.
You may retrieve the results at
http://www.bioinfo.rpi.edu/applications/mfold/old/mfold/11/06Jan06-11-36-02/.
They will be erased in 30 hours."
the link however arrives at "Sorry, the page you're trying to reach may no longer exist or is temporarily unavailable".
It would be nice... if I could get a chance to get the results before they get erased! (also I explored the page http://www.bioinfo.rpi.edu/applications/mfold/old/cgi-bin/view-folds.html, but get:"There are no folded sequences on file for fh-02.lpa.ens.fr!"
Thanks for your help,
sincerely yours,
F. Heslot M. Zuker replies:
The processing of batch jobs stopped around January 5. Processing was restarted on the 8th, but the backlog was so large that many results had to be erased quickly when the scratch disk filled up.
The server is working properly again. Please resubmit.
Date: Thu Jan 19 23:07:42 EST 2006
Name: Shore rafael
Email:shore@evt.edu URL:http:// Remote Host: pool-70-110-142-122.phil.east.verizon.net
Subject: Perl for parsing the mfold output
Do you know about Perl scripts that able to parse the Mfold output?
Date: Tue Jan 24 11:40:51 EST 2006
Name: Melle Imen RABHI
Email:imenre@gmail.com URL:http://Etudiante en thèse à Institut Pasreur de Tunis Remote Host: gmail.com
Subject: Bonjour Pr Zuker
Cher Professeur Zuker,
j'ai souvent utilisé votre site afin de comparer des séquence mRNA car je travaille sur l'expression de protéines recombinantes dans E.coli et Pichia pastoris, cependant et vu qu’en Tunisie nous n'avons pas de spécialistes dans ce domaine, je n'arrive pas à comprendre beaucoup de choses, même si j'ai fait l'assai de comprendre le B.A.B de la thermodynamique, je voudrais SVP vous demander de m'aider à comprendre la différence entre deux séquence mRNA du point de vue énergétique et donc d'établir laquelle des structures est la plus stable. j'ai soumis les deux séquences, et j'ai eu pour chacune deux valeur d'enthalpie libre:
- Séq 1: dG= -127.47 [Initially -140.51]
-Séq 2: dG= -142.55 [Initialy -155.71]
je voudrais aussi comprendre SVP pourquoi a t-on deux valeur dG différentes sur la figure jpg pour la même séquence bien sure. C ‘est à dire : dG= -127.47 [Initially -140.51]
A chaque fois je choisie la structure 1, cependant je voudrai savoir sur qu’elle base choisir la structure adéquate, proposé parmi les trente choisis par le programme.
Merci Pr Zuker, pour votre aide précieuse,
Imen RABHI
Etudiante en thèse de microbiologie
Institut pasteur de Tunis M. Zuker replies: I have finally begun an FAQs web page to answer this question right now. I intend to add others.
Date: Wed Jan 25 11:11:39 EST 2006
Name: Lakshmi Kumar
Email:lmatukum@gmu.edu URL:http:// Remote Host: ba054208.ba.ars.usda.gov
Subject: mfold local program Vs Web server
Dear Dr. Zuker,
I was trying to run the mfold program from the web interface and from my linux box. I was getting different outputs for the same program options. That made me puzzled and after several attempts I found that formatting the sequence made the difference.
I had a 130 bp sequence on a single line that gave a different output than when I wrapped the same sequence into 4 lines. I think it has to do with basic fasta sequence file parsing. I appreciate if you can fix that in your next mfold version.
regards,
Lakshmi Kumar M. Zuker replies: The 'reformat-seq.sh' script in my first release of mfold version 3.2 had a tiny bug in it that caused the last line in FASTA formatted sequence files to be ignored. This was corrected in mid-December (2005) and any download of mfold since that time should not have that problem. For the convenience of users, I have placed the corrected version of the 'reformat-seq.sh' script on the web site where the mfold software is distributed. Please refer to the mfold software download page.
Date: Thu Jan 26 09:51:02 EST 2006
Name: Imen
Email:imenre@gmail.com URL:http://tunisia Remote Host: gmail.com
Subject: some one can help please :)
Dear Sir,
i want to compare 2 mRNA stabilirty, i work on recombinant protein expression, so ihave to check if the corresponding mRNA are stable.
i have used mfold site to determine the mRNA séquence of 2 different proteins. the results are :
1- Séq 1: dG= -127.47 [Initially -140.51]
2- Séq 2: dG= -142.55 [Initialy -155.71]
my questions are:
1- why we have two different enthalpie for a same mRNA, in another word why the results shows 2 dG exp:dG= -127.47 and Initially -140.51
which one i have to take?
2- from which valeur i can say that my mRNA sequence is stabl??
thank you for your precious help!!
Imen RABHI
TUNISIA
Date: Mon Jan 30 11:46:38 EST 2006
Name: Zhili Wang
Email:wangz@email.chop.edu URL:http://napcore.res.chop.edu Remote Host: napcore.res.chop.edu
Subject: DNA folding program
Hi,
Thanks for your program. I run a core lab, often we have to sequence samples that have secodary structures. It is essential to us to know that the sequencing stops are caused by such structures. Your program clearly finds these secondary structures. Convincing in light of our sequencing results.
Zhili
Date: Tue Jan 31 13:54:06 EST 2006
Name: Michael Zuker
Email:zukerm@rpi.edu?Subject=NSFZ URL:http:// Remote Host: cpe-69-204-129-133.nycap.res.rr.com
Subject: Testing anti-spam trap.
I apologize to all, but I was forced to implement a simple anti-spam measure.
Michael Zuker Date: Fri Feb 10 03:48:33 EST 2006
Name: Mr.Sarayoot Subpasu
Email:sarayoot@dmsc.moph.go.th URL:http:// Remote Host: 203.157.48.150
Subject: I have no comment, whereas I thank both of you, Drs D. Stewart and M. Zuker, very much for invention this software. She help me every time when I have problem about DNA/RNA Folding.
Date: Fri Feb 17 15:49:29 EST 2006
Name: Alberto
Email:ucalber@yahoo.com.mx URL:http://www.cicy.mx Remote Host: mipc.cicy.mx
Subject: question
I have been working with the program mfold 3.2 in order to obtain the secundary structure of citrus viroids. The viroids are circles ARNs of single strand. this program built 15 diferents structures, so that, my problem is What structure is the best?.
Date: Sat Feb 18 18:11:02 EST 2006
Name: Pedro
Email: URL:http:// Remote Host: ppp-71-136-44-83.dsl.sndg02.pacbell.net
Subject: Hello Professor,
I have downloaded mfold 3.2 on my linux machine, I attempt to run mfold from the command line entering >#mfold SEQ='goo.fa-local.seq'
and I get the following error:
REUSE= NO
auxgen failed
Job Aborted
Any suggestions?
Gracias,
Pedro M. Zuker replies: It would help if you had left an E-mail address.
It appears that you have not defined an environment variable, $MFOLDDAT. This is the absolute path to the mfold data files. It is the same as 'DATDIR' in Makefile. For example, I use /usr/local/share/mfold as a repository for these files. Try again once you have defined and exported this environment variable in your .bashrc (or equivalent) file in your home directory.
I assume that you sequence file is in FASTA format. Look in the '.log' file after a job fails. Try this and see what happens.
Date: Thu Mar 23 11:19:14 EST 2006
Name: Blake Meyers
Email:meyers@dbi.udel.edu URL:http:// Remote Host: host-254-28.nss.udel.edu
Subject: bug in folding results
Hi,
I'm looking at the output of my folded DNA sequence, and when I try to use the option " Click on the image and redraw the structure with options below." in the output window, instead of redrawing it with the new magnification and image width, it shows me the stuctural details. Because of this, there is apparently no way to access a different sized image.
The page on which this occurs is here:
but I've tried folding a few times over the last couple of weeks and always found the same bug.
Fortunately, there is a work around, which is to use the link you've provided on the results page entitled "Click Here for New Structure Viewing Options." However, it would be helpful if the option functioned to redraw the image.
I think it's probably a minor problem with the html.
thanks for your help,
Blake
Date: Mon Mar 27 12:01:38 EST 2006
Name: Chuanhua
Email:cxing@ncsu.edu URL:http://www4.ncsu.edu/~cxing Remote Host: gumby.csc.ncsu.edu
Subject: The difference between the stack and the terminal stack
Dr. Zuker,
I was working on splice sites' identification using free energies. I was confused by the difference of the stack and the terminal stack for a while, and can't find the right material to answer it. So can you help me out of this?
When I checked the free energy parameters from your website, I found you listed the different free energy parameters for the stacking and the terminal stacking ( and hairpin). I see that the stack is for the helix. The question is how to define a helix when you're predicting a secondary structure? Since it's easy to get confused with the terminal stacking. For example, you're considering a stack for helix. When 1 or 2 mismatches occur, is that still the stack for a helix? If not, why there are the free energies given in the table? If is, what's the difference between them then?
I hope I make the question clear. This will help me a lot. Thanks a lot.
Date: Mon Mar 27 13:16:53 EST 2006
Name: haiyanwu
Email:haiyanwucau@gmail.com URL:http:// Remote Host: 222.45.233.18
Subject: how to use local mfold for batch job?
Dear Dr. Zuker:
I install mfold on my linux system.But I find it a big task to run mfold for plenty of seqence.Could you give me some help for how to use mfold for batch job?
Date: Fri Apr 14 03:34:57 EDT 2006
Name: KIM
Email:khk1329@snu.ac.kr URL:http:// Remote Host: 147.46.63.254
Subject: Wow, this is a good program.
I used it very thanksfully.
But Can I ask something?
When I process one nucleotide sequence, 3 more structures are outputed. How can I analysis this problem?
Date: Tue Apr 18 04:56:34 EDT 2006
Name: irum nawaz
Email:irumnawazawan@yahoo.com URL:http:// Remote Host: ntc.net.pk
Subject: how tom interpret thr results of mfold for RNA folding?
Date: Mon Apr 24 17:50:18 EDT 2006
Name: Aron Yoffe
Email:ayoffe@chem.ucla.edu URL:http:// Remote Host: d-128-97-138-28.chem.ucla.edu
Subject: Problem with "corrected" free energies
Dear Dr. Zuker:
I’m interested in folding large RNAs (2000 bases or greater), and averaging over all
structures within kT of the minimum free energy structure. I’d like to do this using the
“corrected” free energies which, as you explained in an earlier response, are “better.”
Unfortunately, as currently configured, your program seems not to permit this. Indeed, it
appears it may typically not even permit you to see the minimum corrected free energy
structure. To explain why, consider the following results for a 2117 base RNA, folded
using various parameters. [Note: W is window, MAX is the number of structures
outputted, MIFE is the “minimum initial free energy,” i.e., the dG of the structure with the
minimum initial (uncorrected) dG, and MCFE is the “minimum corrected free energy,” i.e.,
the dG of the structure with the minimum corrected dG. The MIFE structure is typically
different from the MCFE structure. All of these results were obtained using the Mfold
server at RPI.]
W = default (25) and MAX = default (50) => MIFE = -780.7, MCFE = -729.48
(the initial dG of the -729.48 MFCE structure is -776.6)
W = 0 and MAX = default (50) => MIFE = -780.7, MCFE = -728.26
(the initial dG of the -728.26 MFCE structure is -779.6)
W = 0 and MAX = 100 => MIFE = -780.7, MCFE = -729.12
(the initial dG of the -729.12 MFCE structure is -779.2)
As expected, the MIFE is independent of the values of W and MAX. So why is this not the
case with the MCFE? Here’s what I think is happening: Mfold only performs the corrected
calculation upon the outputted structures. The family of structures that are outputted
depends upon the settings for W and MAX. So changing these parameters changes the set
of structures for which the correction is calculated. Indeed, the MCFE structures for W =
0, with both MAX = default (50) and MAX = 100, don’t appear until you get to the
HIGHEST initial dG structures among these sets! Thus, the MCFE structure for W = 0 and
MAX = 100 has an initial dG so high that it is not included in the W = 0, MAX=default (50)
set. And the MCFE structure for W = default has an initial dG of -776.6 – too high to be
seen in either of the W = 0 sets. Based on the typical spacing of initial dG’s in the W = 0
sets, I’d estimate that you’d have to output ~300 structures before you’d get to an initial
dG of -776.6; but the server doesn’t allow you to output that many structures – and
neither do the locally compiled versions of Mfold!
So the bottom line appears to be that it’s a matter of luck whether the true MCFE structure
shows up among the outputted structures: if you set W = 0 you may miss it because it has
an initial dG too high to be present among the outputted structures; and if you set W
higher than 0 the true MCFE structure may be among one of the structures that were
skipped.
Here’s a possible solution: First, ask the user to specify, up front, whether he or she wants
corrected free energies. If so, then using W = 0, have Mfold output a sufficiently large
number of structures internally. [“Sufficiently large” means large enough that you are sure
that the true MCFE structure will be included in this set.] Then, using a larger W (perhaps
the default), calculate the corrected dG’s on selected structures within this set; this will
enable the program to identify the types of structures that give the lowest corrected dG’s.
Then, for every structure in the neighborhood of these low corrected dG structures,
calculate a corrected dG. Finally, order these and output them according to the W and
MAX settings specified by the user. [Or, you could just use the brute force method of
calculating corrected dG’s for every structure in the original “sufficiently large” group.]
Let me also suggest that you should offer this modification for the downloadable version
as well as the server program, for two reasons: (1) the distinction between initial and
corrected dG’s is an issue of concern for serious Mfold users, and many serious Mfold
users employ the downloadable version; (2) this modification may be computationally
intensive, and may bog down your server.
Speaking of the downloadable versions of Mfold, I’ve got both 3.1 and 3.2 running on my
Mac G5 (OSX 10.3.9). Version 3.1 runs fine – it gives the same results as the server
(though, when using W = 0, you need to add “RUN_TYPE = html” to get the correct results
– a highly non-obvious point that I was unable to find in the documentation) (without
“RUN_TYPE = html,” the output skips structures – i.e., it acts as if W were set to some
value greater than zero). The only significant limitation of 3.1, for me, is that it does not
give corrected dG’s.
Version 3.2 (downloaded a month ago), on the other hand, behaves oddly. Using the same
2117-base RNA tested above, this is what I’ve found: First, it does not give the same
family of structures as the server, regardless of what I do with the parameters. Second, if I
don’t specify MAX (resulting in a default of 100), or if I explicitly specify MAX = 100, the
.ct file provides initial dG’s only, and is ordered according to them. But if I specify a MAX
of 50 or less, the .ct file contains both initial and corrected dG’s, and orders the structures
according to the latter. [The program does not output a separate “sort” file like the server
does.] Third, version 3.2 crashes if I give it the full path of the .seq file; instead, I have to
eliminate the path and run it from the directory containing the .seq file; otherwise, it saves
the .sav file using a .sa extension, which is of course not recognized by other modules of
the program (I don’t have this problem with version 3.1). It almost seems as if the version
on the RPI server is more like downloadable version 3.1, with added features (e.g.,
corrected free energies), rather than downloadable version 3.2.
Finally, in your response to my last guestbook entry (thank you), you mentioned that “the
Mfold software is now mostly obsolete,” having been superseded by Oligo Array Aux,
created by your student, Nick Markahm. Is Oligo Array Aux more advanced because it, by
default, calculates dG’s equivalent to the corrected dG’s from Mfold? I.e., with the
corrected dG’s, is Mfold as advanced as Oligo Array Aux? [I’ve tried Oligo Array Aux, and
it wasn’t clear to me how to get the equivalent of a W = 0 output; also, it overloads my
computer’s memory when given very long (>10,000 bases) RNAs.]
Sincerely,
Aron Yoffe
Dept. of Chemistry, UCLA
Date: Thu Apr 27 11:13:27 EDT 2006
Name: masciocchi
Email:joel@crs4.it URL:http:// Remote Host: bioinfo08.crs4.it
Subject: problem mfold avec le tail et sort
Date: Thu Apr 27 11:22:32 EDT 2006
Name: masciocchi
Email:joel@crs4.it URL:http:// Remote Host: bioinfo08.crs4.it
Subject: problem mfold avec le tail et sort
Bonjour
Quand je lance le programme mfold j'ai deux erreurs qui apparaissent
La premiere est
tail: Ne peut ouvrir `+2' en lecture: Aucun fichier ou répertoire de ce type
J' ai resolu ce probleme en ajoutant l'option --lines dans le script mfold
La deuxieme erreur est
sort: Échec d'ouverture: +4: Aucun fichier ou répertoire de ce type
Je n'arrive pas a resoudre celle la
Si vous avez une suggestion
Cordialement
Date: Mon May 8 10:20:39 EDT 2006
Name: Michael Widmann
Email:michael.widmann@itb.uni-stuttgart.de URL:http:// Remote Host: cortex02.biologie.uni-stuttgart.de
Subject: auxgen failed error message
Dear Dr. Zuker,
I'm currently trying to implement MFOLD 3.2 on my linux computer but I get the same error message like some other people who posted on this forum
"REUSE= NO
/home/mwi/local/bin/mfold: line 133: reformat-seq.sh: command not found
auxgen failed
Job Aborted
"
You suggested to the last poster that he should set the environment variable, $MFOLDDAT. I have done this and can "start" MFOLD (displaying the various optioan avalable), as soon as I try to load a sequence however it only gives me this error message.
thanks for your help,
Michael
Date: Sun May 21 15:55:10 EDT 2006
Name: George Gutman
Email:gagutman@uci.edu URL:http:// Remote Host: galah.mmg.uci.edu
Subject: Looking for address
Michael,
Tried to send a message to "zuckerm@rpi.edu" but it got bounced, even with the anti-spam message inclusion. How can I get hold of you?
George
PS: "page" in French is feminine..."cette page"
M. Zuker replies: Oops! Pardon my French! The error is corrected. PS: My surname is "Zuker", not "Zucker". Try writing to zukerm@rpi.edu with the anti-spam message in the subject.
Date: Mon May 22 13:34:18 EDT 2006
Name: Bob Bryan
Email:rnbryan@mac.com URL:http:// Remote Host: 24-113-11-184.wavecable.com
Subject: bcl2 start
Michael, it's great to see you ended up at my alma mater. I graduated from RPI in 1958
with a BS in Electrical Engineering. I believe we last spoke in person when you visited my
lab at Affymetrix in 1992 or 1993. I think you were doing a short sabbatical at Stanford
then. I first became aware of your work when I was designing DNA probes at Gen-Probe in
the 1980s. I was working with Carl Woese and one of his graduate students, Robin Gutell.
After Affymetrix, I continued to develop DNA probes, both as diagnostics and anti-sense
therapeutics at Genta and finally at ID Biomedical in Vancouver/Seattle. GlaxoSmithKline
acquired ID Biomedical last year and I retired to an island in Puget Sound. If I visit campus
for my 50th reunion in 2008, I'll look you up.
Bob Bryan
Date: Tue May 23 05:43:27 EDT 2006
Name: joel
Email:joel@crs4.it URL:http:// Remote Host: bioinfo08.crs4.it
Subject: Hello
I would know why the results (the energy dG and the .ct file) between mfold and Unafold are differents
When I launch with "./mofld SEQ=sample1" (is the same sample which can we found on http://www.bioinfo.rpi.edu/%7ezukerm/seqanal/node14.html); I obtaint the same results
But when I launch "Unafold.pl sample1" with the same sequence I obtaint dG = -9.4 instead of dG = -9.8 and the file sample.ct
I launch Unafold with this sequence AAGGGGUUGGUCGCCUCGACUAAGCGGCUUGGAAUUCC and select the "P" option where -P 25 ; I don't obtaint the same results with mfold because it's yet a problem of energy that differs
An other question when I launch mfold I obtain the file".out" it is possible to obtain also this file with Unafold ?
Cordially
Date: Wed May 24 03:59:56 EDT 2006
Name: Philip Kensche
Email:pkensche@cmbi.ru.nl URL:http://www.cmbi.ru.nl/ Remote Host: cmbipc104.cmbi.ru.nl
Subject: sort, head and tail
I had some problems with sort, head and tail on my system. Apparently, by default the newer versions of these tools do not support the "head -1", "tail +2" and "sort +4" syntax anymore.
However, adding the line
export _POSIX2_VERSION=0
to the beginning of the mfold and reformat-seq.sh scripts solved this problem for me. Date: Fri May 26 13:09:50 EDT 2006
Name: Antonio Tito
Email:tito1902000@yahoo.com URL:http:// Remote Host: cpe-66-69-187-210.houston.res.rr.com
Subject: predicted Stem loop DATABASE secondary structure search
Dear Dr. Zuker,
I have a big database of more than 1500 stem loop sequences for which I am look their structures. Is there any way that I could do it automatically without having to input those into the website? I tried downloading the OligoArray program but it is not opening: "unknown file". Please help.
Sincerely,
Antonio Tito
-UH-Gao Research Group-Student Researcher
Date: Tue May 30 06:27:57 EDT 2006
Name: Yiannis Vasilopoulos
Email:vasilopoulos@fleming.gr URL:http:// Remote Host: ns1.fleming.gr
Subject: Request for assistance
Dear Dr Zuker,
I am writting regarding the use of Mfold. i find it a wonderful tool for predicting RNA secondary structure.
My worry is that I have tried to analyse some seqs and still have no results come back to me (for over 2 weeks now). I have used this program with no problems before.
Is there a problem in the Mfold Database?
Thank you very much,
Kind Regards,
Yiannis Vasilopoulos
Date: Mon Jul 17 19:48:00 EDT 2006
Name: Tayyba Baig
Email:tayyba.baig@umontana.edu URL:http:// Remote Host: umma002.dn70.umontana.edu
Subject: question about old version of MFOLD
Hi Sir,
I wish to ask a question about the old version of MFOLD and its comparison with the new
version. I was trying to (fold) make the structure of RNA 1-561 long nucleotides at
different temperatures with old version because the new is fixed at 37C0. When I tried to
make the same sequence at 37co with the old version. It gave me the different
structure(folding). I thought it will be the same because I m using the same temperature. I
tried it several times and the same . i though i m making some mistakes. But may be there
is some difference of parameters i tried to have the same. but still different. Could you
please help me and guide me , where i m making mistake or the old and new versions are
difenert.
Thanking in anticipation
waiting anxiously for your reply
regards
Tayyba Baig
M. Zuker replies: You are not making a mistake. Version 2.3 (old) and 3 are different and do not give identical results at 37 ºC.
Date: Tue Jul 18 10:29:47 EDT 2006
Name: Yanrong Wu
Email:ellenwu@ufl.edu URL:http:// Remote Host: open.chem.ufl.edu
Subject: can I check the secondary structure for 1731 bases RNA by mfolder? And how?
can I check the secondary structure for 1731 bases RNA by mfolder? And how? I once tried to use the one online to analyze it, but failed. Thanks a lot.
M. Zuker replies: You can fold
up to 6000 bases on the mfold web server. Use the batch mode for sequences longer than 800 bases.
Date: Wed Jul 26 17:16:01 EDT 2006
Name: phil dru
Email:dru@obs-vlfr.fr URL:http://biodev.obs-vlfr.Fr Remote Host: cumm024-0b02-dhcp-146.bu.edu
Subject: suggestion
Hello;
Just to tell you i m terribly glad to use your software.
but i want just one thing if it's possible : can you keep be aware of the upper/lower case (we can figure out some part of the sequences with that option) ? Now, the sequence are transformed in upper case. It will help us very much (and almost of our colleagues to make this (it is not very hard i think)
the other thing is to correct your french (glad you want to speak frenchie !
Veuillez remplisser votre message dans l'éspace ci-dessous. Il n'est pas neçessaire de remplir toutes les cases.
Veuillez remplir votre message dans l'éspace ci-dessous :
*the end is not necessary.... thanks again.
Best regards.
Philippe Dru M. Zuker replies:
Both done.
Date: Tue Aug 1 12:25:17 EDT 2006
Name: Celeste
Email:ccla@cib.csic.es URL:http://www.cib.csic.es Remote Host: mepa2.cib.csic.es
Subject: Problem with M´fold
Hello,my name is Celeste.I'm using your M-Fold program for RNA. When I obtain my RNA structure and I want to change values and redraw it, I can't obtain a new structure clicking in the image. Please,can you tell me if this is a bug in the program or if I'm doing it correctly?
Thank you in advanced four your kind attention.
M. Zuker replies:
If you are using the mfold web server, then you should read my paper in the July 2003 web server issue of Nucleic Acids Research. The important thing to remember is that you must check the radio button "Click on the image and redraw the structure with options below". Otherwise, no images will be redrawn.
If you are using the command line version of mfold downloaded from my web site, then you need to download the mfold_util software and use the interactive graphics program, sir_graph. You may need help from a systems person to configure and build the mfold_util software.
Date: Thu Aug 3 03:07:27 EDT 2006
Name: Ada
Email:s050428@cuhk.edu.hk URL:http:// Remote Host: csc0g02prb.net.cuhk.edu.hk
Subject: Tm ?
Why I obtein two different Tm for the same sequence under the same settings ? ( two measurements apart sevral month )
Date: Fri Sep 22 19:29:52 EDT 2006
Name: Rosie Redfield
Email:redfield@interchange.ubc.ca URL:http://rrresearch.blogspot.com Remote Host: 142.103.44.123
Subject: Who am I?
I'm deep into Mfolding our sxy RNAs. The screen keeps asking who I am, but I don't know
how to give my Powerbook an identity that your site can read. Do I need to get my sysadmin
to do it for me?
Rosie
p.s. Check out my research blog, and our new lab web pages.
M. Zuker replies:
Hi Rosie! I enjoyed your research blog.
The annoying "who are you?" flag is deliberate and appears when the incoming IP address cannot be resolved. For example, your IP address is "142.103.44.123". It cannot be translated into something like "xxx.yyy.ubc.ca", for example. This is the fault of your systems administrator.
Date: Mon Oct 16 01:34:55 EDT 2006
Name: Harini
Email:hgopalak@indiana.edu URL:http:// Remote Host: 64.151.173.162
Subject: Problem on FASTA header being lengthy?
Hi,
I tried folding using the local version of UNAfold on a linux machine, and got the below error memory allocation error when I ran it for a file with a lengthy FASTA sequence.
***Error****
realloc(): invalid next size: 0x094c04e8 ***
Exit status 0 from hybrid-ss-min
*****************************
It ran fine, when I trimmed the FASTA header line.
Is there a restriction on the length of the header for each sequence in FASTA?
Btw, I do find your tool very useful, and am using it for my project on RNA folding analysis! Thanks a lot for the same.
M. Zuker replies:
I was able to duplicate your error. I looked into the code, written by Nick Markham, and discovered that the sequence name is defined to have up to 80 characters. This size should be expandable, but something goes wrong when the size exceeds 87. For now, use shorter names in the FASTA header line, or edit the 'util.h' file and change '80' to '120' (or whatever you want) in the 'input' function. That is, replace '*name = xmalloc(80);' with '*name = xmalloc(120);'. This should work. This bug will be fixed properly in the next release of the software. Thank you for reporting it.
Date: Fri Oct 20 03:57:00 EDT 2006
Name: Jeffrey
Email:g0500396@nus.edu.sg URL:http:// Remote Host: pali-ext.nus.edu.sg
Subject: Hebrew calendar
Dr Zuker, I was visiting your webpage in search of the mFOLD program for my research work and I was both surprised and fascinated that you have incorporated a software to calculate the dates in the Hebrew calendar. It's interesting. I am a beginner in the Hebrew language.
Jeffrey (Singapore)
Date: Mon Oct 30 02:21:50 EST 2006
Name: Pradeep Aggarwal
Email:pradeep.a@ocimumbio.com URL:http:// Remote Host: lline-202-65-145-202.pol.net.in
Subject: Regd UNAfold
I was wondering if the DNAFold and hybrid-ss-min (UNAFold utility) should give me the same results or not. I tried it on the same sequence and same parameter but the txt file(DNAfold) and the PLOT file (UNAFold) are giving different replace.
Can you suggest why is this happening and secondaly which utility should I use from UNAFold package that replaces DNAFold.
Date: Tue Oct 31 20:54:41 EST 2006
Name: Mark Schultz
Email:mark.schultz@cdu.edu.au URL:http://www.atrf.org.au/researchers.php/ Remote Host: 138.80.201.24
Subject: Thanks for Mfold
Hi Michael,
Thanks for writing the MFold program.
Best regards,
Mark
Date: Mon Nov 6 21:07:29 EST 2006
Name: Trina Norden-Krichmar
Email:tnordenk@ucsd.edu URL:http:// Remote Host: 132.239.168.178
Subject: mfold output from UNAfold?
Hello,
I have been using mfold for about a year. Recently, I decided to switch over to UNAfold. The program seems to work fine, but it does not generate the same output files.
For example, the .gif files that were generated by mfold are not produced by any of the programs in UNAfold that I have tried. The only way that I was able to get a graphical output of a ssRNA was through the web interface program QuikFold. I did not find a copy of the Quikfold program in the download of UNAfold, so I was wondering if there was a way that I could get a copy??
Also, I like the standard output of mfold, which shows a text version of the structure with the nucleotides and their numbers in the sequence. Is there a way to get such output in any of the UNAfold programs?
Any information would be greatly appreciated!!
Thanks,
Trina Date: Fri Dec 1 12:02:54 EST 2006
Name: Roland Gaboury
Email:rolandgaboury@gmail.com URL:http:// Remote Host: h64-5-222-18.gtcust.grouptelecom.net
Subject: Greetings
Hi Michael. I figured you'd be wondering who that was that came by your site, so I figured I should leave a message. Not to mention, I'm MUCH closer to you now... I have relocated to the Maritimes and now have a house in Dartmouth, NS with my wife Isabelle. I'm working as a senior engineer for Brooke Ocean Technology, and my wife is a scientific programmer / modeller / acoustician at Jasco Research. At any rate, should you ever be inclined, give me a call at 902-446-5873, or if you're in the neighborhood, I'd be delighted to introduce you to Isabelle and have you over for dinner... possibly even paella... Cheers.
Roland
Date: Wed Dec 6 01:04:01 EST 2006
Name: Kyung Hyun Lee
Email:doccabi@kist.re.kr URL:http:// Remote Host: 147.46.44.16
Subject: Thanks!! M-fold server give me useful information for prediction of RNA secondary structure~ Thank you,sir~ Dr. Zuker!
Date: Wed Dec 6 17:10:21 EST 2006
Name: Marco Mangone
Email: URL:http:// Remote Host: Subject: installation problem
Dear Dr. Zuker,
I have the following problem with mfold:
when I type:
mfold SEQ=seq.fasta
I get
cat: /home/marco/mfold/unafold-3.3/data/begin.dat2: No such file or directory
REUSE= NO
auxgen failed
Job Aborted
the file seq.log (whis is created everytime I run mfold) reports:
auxgen: error while loading shared libraries: libg2c.so.0: cannot open shared ob
ject file: No such file or directory
do you have any clue what I am doing wrong ?
thanks,
Marco Date: Fri Dec 8 05:46:03 EST 2006
Name: Elena Korchagina
Email:misterix@rambler.ru URL:http:// Remote Host: vpn2-nat2.starlink.ru
Subject: Structure rotation does not work!
Structure rotation does not work! Please, make it work or instruct me what I may do wrong. Thank you.
M. Zuker replies:
I think that you are wrong. I just checked, and structure rotation is working perfectly. It is working when the structure rotation option is chosen on the folding form and it is also working when structures are redrawn interactively. I cannot help you unless you provide more details.
¤
Name: Jing Zhang
Email: zhangjing@hrbeu.edu.cn
URL: http://
Remote Host: 218.7.43.222
Subject: apply for postdoctor position
Can I apply for postdoctor in your place?
Name: Agnieszka
Email: tango@man.poznan.pl
URL: http://
Remote Host: dcs-rp.cs.put.poznan.pl
Subject: length of sequence - still problem
Dear Dr. Zuker,
I've similar problem to Trina (explained by her above).
When I run a sequence through mfold from a
command line on my local installation, it does not use all nucleotides from my sequence, but only part of them (e.g. 225 instead of 260). There is no such problem when using mfold through web interface.
I tried your solution with assuring that each line contains no more than 80 nucleotides, but it didn't help.
Do you have any idea what is happening? I would be very grateful for any help. I'm looking forward to hearing from you.
best regards,
Agnieszka
M. Zuker replies: mfold version 3.2 has a script named reformat-seq.sh that solves the long line problem. The first version introduced a bug that truncated the sequence! This was fixed on December 10, 2005. Any download of mfold-3.2 after this date will not have this error. The version of reformat-seq.sh obtained by following the above hyper-link is correct.
Name: ElsV
Email: els.vanbleu@telenet.be
URL: http://
Remote Host: 213.193.133.122
Subject: Vienna output format
Dear Dr. Zuker,
I was wondering if any one has ever tried to parse the output automatically from Mfold in any way (e.g. by using perl)?
Name: HESLOT Francois
Email: heslot@lpa.ens.fr
URL: http://
Remote Host: fh-02.lpa.ens.fr
Subject: impossible to get results from batch folding
Dear Sir,
I used the Mfold server (that I appreciate a lot), to get 4 long sequences folded, using the batch option (logged on friday jan 6th).
This morning (1-10-2006), I received the e-mail notifications of the results, from no_reply@bioinfo.rpi.edu. All the links transmitted have problems. Here is one of mail received:
"The folding of oxa _7 inverse aaa_1_ is completed.
You may retrieve the results at
http://www.bioinfo.rpi.edu/applications/mfold/old/mfold/11/06Jan06-11-36-02/.
They will be erased in 30 hours."
the link however arrives at "Sorry, the page you're trying to reach may no longer exist or is temporarily unavailable".
It would be nice... if I could get a chance to get the results before they get erased! (also I explored the page http://www.bioinfo.rpi.edu/applications/mfold/old/cgi-bin/view-folds.html, but get:"There are no folded sequences on file for fh-02.lpa.ens.fr!"
Thanks for your help,
sincerely yours,
F. Heslot
M. Zuker replies: The processing of batch jobs stopped around January 5. Processing was restarted on the 8th, but the backlog was so large that many results had to be erased quickly when the scratch disk filled up.
The server is working properly again. Please resubmit.
Name: Shore rafael
Email: shore@evt.edu
URL: http://
Remote Host: pool-70-110-142-122.phil.east.verizon.net
Subject: Perl for parsing the mfold output
Do you know about Perl scripts that able to parse the Mfold output?
Name: Melle Imen RABHI
Email: imenre@gmail.com
URL: http://Etudiante en thèse à Institut Pasreur de Tunis
Remote Host: gmail.com
Subject: Bonjour Pr Zuker
Cher Professeur Zuker,
j'ai souvent utilisé votre site afin de comparer des séquence mRNA car je travaille sur l'expression de protéines recombinantes dans E.coli et Pichia pastoris, cependant et vu qu’en Tunisie nous n'avons pas de spécialistes dans ce domaine, je n'arrive pas à comprendre beaucoup de choses, même si j'ai fait l'assai de comprendre le B.A.B de la thermodynamique, je voudrais SVP vous demander de m'aider à comprendre la différence entre deux séquence mRNA du point de vue énergétique et donc d'établir laquelle des structures est la plus stable. j'ai soumis les deux séquences, et j'ai eu pour chacune deux valeur d'enthalpie libre:
- Séq 1: dG= -127.47 [Initially -140.51]
-Séq 2: dG= -142.55 [Initialy -155.71]
je voudrais aussi comprendre SVP pourquoi a t-on deux valeur dG différentes sur la figure jpg pour la même séquence bien sure. C ‘est à dire : dG= -127.47 [Initially -140.51]
A chaque fois je choisie la structure 1, cependant je voudrai savoir sur qu’elle base choisir la structure adéquate, proposé parmi les trente choisis par le programme.
Merci Pr Zuker, pour votre aide précieuse,
Imen RABHI
Etudiante en thèse de microbiologie
Institut pasteur de Tunis
M. Zuker replies: I have finally begun an FAQs web page to answer this question right now. I intend to add others.
Name: Lakshmi Kumar
Email: lmatukum@gmu.edu
URL: http://
Remote Host: ba054208.ba.ars.usda.gov
Subject: mfold local program Vs Web server
Dear Dr. Zuker,
I was trying to run the mfold program from the web interface and from my linux box. I was getting different outputs for the same program options. That made me puzzled and after several attempts I found that formatting the sequence made the difference.
I had a 130 bp sequence on a single line that gave a different output than when I wrapped the same sequence into 4 lines. I think it has to do with basic fasta sequence file parsing. I appreciate if you can fix that in your next mfold version.
regards,
Lakshmi Kumar
M. Zuker replies: The 'reformat-seq.sh' script in my first release of mfold version 3.2 had a tiny bug in it that caused the last line in FASTA formatted sequence files to be ignored. This was corrected in mid-December (2005) and any download of mfold since that time should not have that problem. For the convenience of users, I have placed the corrected version of the 'reformat-seq.sh' script on the web site where the mfold software is distributed. Please refer to the
mfoldsoftware download page.Name: Imen
Email: imenre@gmail.com
URL: http://tunisia
Remote Host: gmail.com
Subject: some one can help please :)
Dear Sir,
i want to compare 2 mRNA stabilirty, i work on recombinant protein expression, so ihave to check if the corresponding mRNA are stable.
i have used mfold site to determine the mRNA séquence of 2 different proteins. the results are :
1- Séq 1: dG= -127.47 [Initially -140.51]
2- Séq 2: dG= -142.55 [Initialy -155.71]
my questions are:
1- why we have two different enthalpie for a same mRNA, in another word why the results shows 2 dG exp:dG= -127.47 and Initially -140.51
which one i have to take?
2- from which valeur i can say that my mRNA sequence is stabl??
thank you for your precious help!!
Imen RABHI
TUNISIA
Name: Zhili Wang
Email: wangz@email.chop.edu
URL: http://napcore.res.chop.edu
Remote Host: napcore.res.chop.edu
Subject: DNA folding program
Hi,
Thanks for your program. I run a core lab, often we have to sequence samples that have secodary structures. It is essential to us to know that the sequencing stops are caused by such structures. Your program clearly finds these secondary structures. Convincing in light of our sequencing results.
Zhili
Name: Michael Zuker
Email: zukerm@rpi.edu?Subject=NSFZ
URL: http://
Remote Host: cpe-69-204-129-133.nycap.res.rr.com
Subject: Testing anti-spam trap.
I apologize to all, but I was forced to implement a simple anti-spam measure.
Michael Zuker
Name: Mr.Sarayoot Subpasu
Email: sarayoot@dmsc.moph.go.th
URL: http://
Remote Host: 203.157.48.150
Subject:
I have no comment, whereas I thank both of you, Drs D. Stewart and M. Zuker, very much for invention this software. She help me every time when I have problem about DNA/RNA Folding.
Name: Alberto
Email: ucalber@yahoo.com.mx
URL: http://www.cicy.mx
Remote Host: mipc.cicy.mx
Subject: question
I have been working with the program mfold 3.2 in order to obtain the secundary structure of citrus viroids. The viroids are circles ARNs of single strand. this program built 15 diferents structures, so that, my problem is What structure is the best?.
Name: Pedro
Email:
URL: http://
Remote Host: ppp-71-136-44-83.dsl.sndg02.pacbell.net
Subject:
Hello Professor,
I have downloaded mfold 3.2 on my linux machine, I attempt to run mfold from the command line entering >#mfold SEQ='goo.fa-local.seq'
and I get the following error:
REUSE= NO
auxgen failed
Job Aborted
Any suggestions?
Gracias,
Pedro
M. Zuker replies: It would help if you had left an E-mail address.
It appears that you have not defined an environment variable, $MFOLDDAT. This is the absolute path to the
mfolddata files. It is the same as 'DATDIR' in Makefile. For example, I use /usr/local/share/mfold as a repository for these files. Try again once you have defined and exported this environment variable in your .bashrc (or equivalent) file in your home directory.I assume that you sequence file is in FASTA format. Look in the '.log' file after a job fails. Try this and see what happens.
Name: Blake Meyers
Email: meyers@dbi.udel.edu
URL: http://
Remote Host: host-254-28.nss.udel.edu
Subject: bug in folding results
Hi,
I'm looking at the output of my folded DNA sequence, and when I try to use the option " Click on the image and redraw the structure with options below." in the output window, instead of redrawing it with the new magnification and image width, it shows me the stuctural details. Because of this, there is apparently no way to access a different sized image.
The page on which this occurs is here:
but I've tried folding a few times over the last couple of weeks and always found the same bug.
Fortunately, there is a work around, which is to use the link you've provided on the results page entitled "Click Here for New Structure Viewing Options." However, it would be helpful if the option functioned to redraw the image.
I think it's probably a minor problem with the html.
thanks for your help,
Blake
Name: Chuanhua
Email: cxing@ncsu.edu
URL: http://www4.ncsu.edu/~cxing
Remote Host: gumby.csc.ncsu.edu
Subject: The difference between the stack and the terminal stack
Dr. Zuker,
I was working on splice sites' identification using free energies. I was confused by the difference of the stack and the terminal stack for a while, and can't find the right material to answer it. So can you help me out of this?
When I checked the free energy parameters from your website, I found you listed the different free energy parameters for the stacking and the terminal stacking ( and hairpin). I see that the stack is for the helix. The question is how to define a helix when you're predicting a secondary structure? Since it's easy to get confused with the terminal stacking. For example, you're considering a stack for helix. When 1 or 2 mismatches occur, is that still the stack for a helix? If not, why there are the free energies given in the table? If is, what's the difference between them then?
I hope I make the question clear. This will help me a lot. Thanks a lot.
Name: haiyanwu
Email: haiyanwucau@gmail.com
URL: http://
Remote Host: 222.45.233.18
Subject: how to use local mfold for batch job?
Dear Dr. Zuker:
I install mfold on my linux system.But I find it a big task to run mfold for plenty of seqence.Could you give me some help for how to use mfold for batch job?
Name: KIM
Email: khk1329@snu.ac.kr
URL: http://
Remote Host: 147.46.63.254
Subject:
Wow, this is a good program.
I used it very thanksfully.
But Can I ask something?
When I process one nucleotide sequence, 3 more structures are outputed. How can I analysis this problem?
Name: irum nawaz
Email: irumnawazawan@yahoo.com
URL: http://
Remote Host: ntc.net.pk
Subject:
how tom interpret thr results of mfold for RNA folding?
Name: Aron Yoffe
Email: ayoffe@chem.ucla.edu
URL: http://
Remote Host: d-128-97-138-28.chem.ucla.edu
Subject: Problem with "corrected" free energies
Dear Dr. Zuker:
I’m interested in folding large RNAs (2000 bases or greater), and averaging over all
structures within kT of the minimum free energy structure. I’d like to do this using the
“corrected” free energies which, as you explained in an earlier response, are “better.”
Unfortunately, as currently configured, your program seems not to permit this. Indeed, it
appears it may typically not even permit you to see the minimum corrected free energy
structure. To explain why, consider the following results for a 2117 base RNA, folded
using various parameters. [Note: W is window, MAX is the number of structures
outputted, MIFE is the “minimum initial free energy,” i.e., the dG of the structure with the
minimum initial (uncorrected) dG, and MCFE is the “minimum corrected free energy,” i.e.,
the dG of the structure with the minimum corrected dG. The MIFE structure is typically
different from the MCFE structure. All of these results were obtained using the Mfold
server at RPI.]
W = default (25) and MAX = default (50) => MIFE = -780.7, MCFE = -729.48
(the initial dG of the -729.48 MFCE structure is -776.6)
W = 0 and MAX = default (50) => MIFE = -780.7, MCFE = -728.26
(the initial dG of the -728.26 MFCE structure is -779.6)
W = 0 and MAX = 100 => MIFE = -780.7, MCFE = -729.12
(the initial dG of the -729.12 MFCE structure is -779.2)
As expected, the MIFE is independent of the values of W and MAX. So why is this not the
case with the MCFE? Here’s what I think is happening: Mfold only performs the corrected
calculation upon the outputted structures. The family of structures that are outputted
depends upon the settings for W and MAX. So changing these parameters changes the set
of structures for which the correction is calculated. Indeed, the MCFE structures for W =
0, with both MAX = default (50) and MAX = 100, don’t appear until you get to the
HIGHEST initial dG structures among these sets! Thus, the MCFE structure for W = 0 and
MAX = 100 has an initial dG so high that it is not included in the W = 0, MAX=default (50)
set. And the MCFE structure for W = default has an initial dG of -776.6 – too high to be
seen in either of the W = 0 sets. Based on the typical spacing of initial dG’s in the W = 0
sets, I’d estimate that you’d have to output ~300 structures before you’d get to an initial
dG of -776.6; but the server doesn’t allow you to output that many structures – and
neither do the locally compiled versions of Mfold!
So the bottom line appears to be that it’s a matter of luck whether the true MCFE structure
shows up among the outputted structures: if you set W = 0 you may miss it because it has
an initial dG too high to be present among the outputted structures; and if you set W
higher than 0 the true MCFE structure may be among one of the structures that were
skipped.
Here’s a possible solution: First, ask the user to specify, up front, whether he or she wants
corrected free energies. If so, then using W = 0, have Mfold output a sufficiently large
number of structures internally. [“Sufficiently large” means large enough that you are sure
that the true MCFE structure will be included in this set.] Then, using a larger W (perhaps
the default), calculate the corrected dG’s on selected structures within this set; this will
enable the program to identify the types of structures that give the lowest corrected dG’s.
Then, for every structure in the neighborhood of these low corrected dG structures,
calculate a corrected dG. Finally, order these and output them according to the W and
MAX settings specified by the user. [Or, you could just use the brute force method of
calculating corrected dG’s for every structure in the original “sufficiently large” group.]
Let me also suggest that you should offer this modification for the downloadable version
as well as the server program, for two reasons: (1) the distinction between initial and
corrected dG’s is an issue of concern for serious Mfold users, and many serious Mfold
users employ the downloadable version; (2) this modification may be computationally
intensive, and may bog down your server.
Speaking of the downloadable versions of Mfold, I’ve got both 3.1 and 3.2 running on my
Mac G5 (OSX 10.3.9). Version 3.1 runs fine – it gives the same results as the server
(though, when using W = 0, you need to add “RUN_TYPE = html” to get the correct results
– a highly non-obvious point that I was unable to find in the documentation) (without
“RUN_TYPE = html,” the output skips structures – i.e., it acts as if W were set to some
value greater than zero). The only significant limitation of 3.1, for me, is that it does not
give corrected dG’s.
Version 3.2 (downloaded a month ago), on the other hand, behaves oddly. Using the same
2117-base RNA tested above, this is what I’ve found: First, it does not give the same
family of structures as the server, regardless of what I do with the parameters. Second, if I
don’t specify MAX (resulting in a default of 100), or if I explicitly specify MAX = 100, the
.ct file provides initial dG’s only, and is ordered according to them. But if I specify a MAX
of 50 or less, the .ct file contains both initial and corrected dG’s, and orders the structures
according to the latter. [The program does not output a separate “sort” file like the server
does.] Third, version 3.2 crashes if I give it the full path of the .seq file; instead, I have to
eliminate the path and run it from the directory containing the .seq file; otherwise, it saves
the .sav file using a .sa extension, which is of course not recognized by other modules of
the program (I don’t have this problem with version 3.1). It almost seems as if the version
on the RPI server is more like downloadable version 3.1, with added features (e.g.,
corrected free energies), rather than downloadable version 3.2.
Finally, in your response to my last guestbook entry (thank you), you mentioned that “the
Mfold software is now mostly obsolete,” having been superseded by Oligo Array Aux,
created by your student, Nick Markahm. Is Oligo Array Aux more advanced because it, by
default, calculates dG’s equivalent to the corrected dG’s from Mfold? I.e., with the
corrected dG’s, is Mfold as advanced as Oligo Array Aux? [I’ve tried Oligo Array Aux, and
it wasn’t clear to me how to get the equivalent of a W = 0 output; also, it overloads my
computer’s memory when given very long (>10,000 bases) RNAs.]
Sincerely,
Aron Yoffe
Dept. of Chemistry, UCLA
Name: masciocchi
Email: joel@crs4.it
URL: http://
Remote Host: bioinfo08.crs4.it
Subject: problem mfold avec le tail et sort
Name: masciocchi
Email: joel@crs4.it
URL: http://
Remote Host: bioinfo08.crs4.it
Subject: problem mfold avec le tail et sort
Bonjour
Quand je lance le programme mfold j'ai deux erreurs qui apparaissent
La premiere est
tail: Ne peut ouvrir `+2' en lecture: Aucun fichier ou répertoire de ce type
J' ai resolu ce probleme en ajoutant l'option --lines dans le script mfold
La deuxieme erreur est
sort: Échec d'ouverture: +4: Aucun fichier ou répertoire de ce type
Je n'arrive pas a resoudre celle la
Si vous avez une suggestion
Cordialement
Name: Michael Widmann
Email: michael.widmann@itb.uni-stuttgart.de
URL: http://
Remote Host: cortex02.biologie.uni-stuttgart.de
Subject: auxgen failed error message
Dear Dr. Zuker,
I'm currently trying to implement MFOLD 3.2 on my linux computer but I get the same error message like some other people who posted on this forum
"REUSE= NO
/home/mwi/local/bin/mfold: line 133: reformat-seq.sh: command not found
auxgen failed
Job Aborted
"
You suggested to the last poster that he should set the environment variable, $MFOLDDAT. I have done this and can "start" MFOLD (displaying the various optioan avalable), as soon as I try to load a sequence however it only gives me this error message.
thanks for your help,
Michael
Name: George Gutman
Email: gagutman@uci.edu
URL: http://
Remote Host: galah.mmg.uci.edu
Subject: Looking for address
Michael,
Tried to send a message to "zuckerm@rpi.edu" but it got bounced, even with the anti-spam message inclusion. How can I get hold of you?
George
PS: "page" in French is feminine..."cette page"
M. Zuker replies: Oops! Pardon my French! The error is corrected.
PS: My surname is "Zuker", not "Zucker". Try writing to zukerm@rpi.edu with the anti-spam message in the subject.
Name: Bob Bryan
Email: rnbryan@mac.com
URL: http://
Remote Host: 24-113-11-184.wavecable.com
Subject: bcl2 start
Michael, it's great to see you ended up at my alma mater. I graduated from RPI in 1958
with a BS in Electrical Engineering. I believe we last spoke in person when you visited my
lab at Affymetrix in 1992 or 1993. I think you were doing a short sabbatical at Stanford
then. I first became aware of your work when I was designing DNA probes at Gen-Probe in
the 1980s. I was working with Carl Woese and one of his graduate students, Robin Gutell.
After Affymetrix, I continued to develop DNA probes, both as diagnostics and anti-sense
therapeutics at Genta and finally at ID Biomedical in Vancouver/Seattle. GlaxoSmithKline
acquired ID Biomedical last year and I retired to an island in Puget Sound. If I visit campus
for my 50th reunion in 2008, I'll look you up.
Bob Bryan
Name: joel
Email: joel@crs4.it
URL: http://
Remote Host: bioinfo08.crs4.it
Subject:
Hello
I would know why the results (the energy dG and the .ct file) between mfold and Unafold are differents
When I launch with "./mofld SEQ=sample1" (is the same sample which can we found on http://www.bioinfo.rpi.edu/%7ezukerm/seqanal/node14.html); I obtaint the same results
But when I launch "Unafold.pl sample1" with the same sequence I obtaint dG = -9.4 instead of dG = -9.8 and the file sample.ct
31 dG = -9.4 sample1
1 A 0 2 0 1 0 0
2 C 1 3 0 2 0 0
- - - - - - - - - - - - - - - - - - - - - - -
30 A 29 31 0 30 0 0
31 A 30 0 0 31 0 0
What are the two last columns ?
I launch Unafold with this sequence AAGGGGUUGGUCGCCUCGACUAAGCGGCUUGGAAUUCC and select the "P" option where -P 25 ; I don't obtaint the same results with mfold because it's yet a problem of energy that differs
An other question when I launch mfold I obtain the file".out" it is possible to obtain also this file with Unafold ?
Cordially
Name: Philip Kensche
Email: pkensche@cmbi.ru.nl
URL: http://www.cmbi.ru.nl/
Remote Host: cmbipc104.cmbi.ru.nl
Subject: sort, head and tail
I had some problems with sort, head and tail on my system. Apparently, by default the newer versions of these tools do not support the "head -1", "tail +2" and "sort +4" syntax anymore.
However, adding the line
export _POSIX2_VERSION=0
to the beginning of the mfold and reformat-seq.sh scripts solved this problem for me.
Name: Antonio Tito
Email: tito1902000@yahoo.com
URL: http://
Remote Host: cpe-66-69-187-210.houston.res.rr.com
Subject: predicted Stem loop DATABASE secondary structure search
Dear Dr. Zuker,
I have a big database of more than 1500 stem loop sequences for which I am look their structures. Is there any way that I could do it automatically without having to input those into the website? I tried downloading the OligoArray program but it is not opening: "unknown file". Please help.
Sincerely,
Antonio Tito
-UH-Gao Research Group-Student Researcher
Name: Yiannis Vasilopoulos
Email: vasilopoulos@fleming.gr
URL: http://
Remote Host: ns1.fleming.gr
Subject: Request for assistance
Dear Dr Zuker,
I am writting regarding the use of Mfold. i find it a wonderful tool for predicting RNA secondary structure.
My worry is that I have tried to analyse some seqs and still have no results come back to me (for over 2 weeks now). I have used this program with no problems before.
Is there a problem in the Mfold Database?
Thank you very much,
Kind Regards,
Yiannis Vasilopoulos
Name: Tayyba Baig
Email: tayyba.baig@umontana.edu
URL: http://
Remote Host: umma002.dn70.umontana.edu
Subject: question about old version of MFOLD
Hi Sir,
I wish to ask a question about the old version of MFOLD and its comparison with the new
version. I was trying to (fold) make the structure of RNA 1-561 long nucleotides at
different temperatures with old version because the new is fixed at 37C0. When I tried to
make the same sequence at 37co with the old version. It gave me the different
structure(folding). I thought it will be the same because I m using the same temperature. I
tried it several times and the same . i though i m making some mistakes. But may be there
is some difference of parameters i tried to have the same. but still different. Could you
please help me and guide me , where i m making mistake or the old and new versions are
difenert.
Thanking in anticipation
waiting anxiously for your reply
regards
Tayyba Baig
M. Zuker replies: You are not making a mistake. Version 2.3 (old) and 3 are different and do not give identical results at 37 ºC.
Name: Yanrong Wu
Email: ellenwu@ufl.edu
URL: http://
Remote Host: open.chem.ufl.edu
Subject: can I check the secondary structure for 1731 bases RNA by mfolder? And how?
can I check the secondary structure for 1731 bases RNA by mfolder? And how? I once tried to use the one online to analyze it, but failed. Thanks a lot.
M. Zuker replies: You can fold up to 6000 bases on the mfold web server. Use the batch mode for sequences longer than 800 bases.
Name: phil dru
Email: dru@obs-vlfr.fr
URL: http://biodev.obs-vlfr.Fr
Remote Host: cumm024-0b02-dhcp-146.bu.edu
Subject: suggestion
Hello;
Just to tell you i m terribly glad to use your software.
but i want just one thing if it's possible : can you keep be aware of the upper/lower case (we can figure out some part of the sequences with that option) ? Now, the sequence are transformed in upper case. It will help us very much (and almost of our colleagues to make this (it is not very hard i think)
the other thing is to correct your french (glad you want to speak frenchie !
Veuillez remplisser votre message dans l'éspace ci-dessous. Il n'est pas neçessaire de remplir toutes les cases.
Veuillez remplir votre message dans l'éspace ci-dessous :
*the end is not necessary.... thanks again.
Best regards.
Philippe Dru
M. Zuker replies: Both done.
Name: Celeste
Email: ccla@cib.csic.es
URL: http://www.cib.csic.es
Remote Host: mepa2.cib.csic.es
Subject: Problem with M´fold
Hello,my name is Celeste.I'm using your M-Fold program for RNA. When I obtain my RNA structure and I want to change values and redraw it, I can't obtain a new structure clicking in the image. Please,can you tell me if this is a bug in the program or if I'm doing it correctly?
Thank you in advanced four your kind attention.
M. Zuker replies: If you are using the
mfoldweb server, then you should read my paper in the July 2003 web server issue of Nucleic Acids Research. The important thing to remember is that you must check the radio button "Click on the image and redraw the structure with options below". Otherwise, no images will be redrawn.If you are using the command line version of
mfolddownloaded from my web site, then you need to download the mfold_util software and use the interactive graphics program, sir_graph. You may need help from a systems person to configure and build the mfold_util software.mfoldis obsolete and has been replaced by UNAFold. You may download both UNAFold and mfold_util at http://www.bioinfo.rpi.edu/applications/hybrid/download.php.mfoldwill remain available.Name: Ada
Email: s050428@cuhk.edu.hk
URL: http://
Remote Host: csc0g02prb.net.cuhk.edu.hk
Subject: Tm ?
Why I obtein two different Tm for the same sequence under the same settings ? ( two measurements apart sevral month )
Name: Rosie Redfield
Email: redfield@interchange.ubc.ca
URL: http://rrresearch.blogspot.com
Remote Host: 142.103.44.123
Subject: Who am I?
I'm deep into Mfolding our sxy RNAs. The screen keeps asking who I am, but I don't know
how to give my Powerbook an identity that your site can read. Do I need to get my sysadmin
to do it for me?
Rosie
p.s. Check out my research blog, and our new lab web pages.
M. Zuker replies: Hi Rosie! I enjoyed your research blog.
The annoying "who are you?" flag is deliberate and appears when the incoming IP address cannot be resolved. For example, your IP address is "142.103.44.123". It cannot be translated into something like "xxx.yyy.ubc.ca", for example. This is the fault of your systems administrator.
Name: Harini
Email: hgopalak@indiana.edu
URL: http://
Remote Host: 64.151.173.162
Subject: Problem on FASTA header being lengthy?
Hi,
I tried folding using the local version of UNAfold on a linux machine, and got the below error memory allocation error when I ran it for a file with a lengthy FASTA sequence.
***Error****
realloc(): invalid next size: 0x094c04e8 ***
Exit status 0 from hybrid-ss-min
*****************************
It ran fine, when I trimmed the FASTA header line.
Is there a restriction on the length of the header for each sequence in FASTA?
Btw, I do find your tool very useful, and am using it for my project on RNA folding analysis! Thanks a lot for the same.
M. Zuker replies: I was able to duplicate your error. I looked into the code, written by Nick Markham, and discovered that the sequence name is defined to have up to 80 characters. This size should be expandable, but something goes wrong when the size exceeds 87. For now, use shorter names in the FASTA header line, or edit the 'util.h' file and change '80' to '120' (or whatever you want) in the 'input' function. That is, replace '*name = xmalloc(80);' with '*name = xmalloc(120);'. This should work. This bug will be fixed properly in the next release of the software.
Thank you for reporting it.
Name: Jeffrey
Email: g0500396@nus.edu.sg
URL: http://
Remote Host: pali-ext.nus.edu.sg
Subject: Hebrew calendar
Dr Zuker, I was visiting your webpage in search of the mFOLD program for my research work and I was both surprised and fascinated that you have incorporated a software to calculate the dates in the Hebrew calendar. It's interesting. I am a beginner in the Hebrew language.
Jeffrey (Singapore)
Name: Pradeep Aggarwal
Email: pradeep.a@ocimumbio.com
URL: http://
Remote Host: lline-202-65-145-202.pol.net.in
Subject: Regd UNAfold
I was wondering if the DNAFold and hybrid-ss-min (UNAFold utility) should give me the same results or not. I tried it on the same sequence and same parameter but the txt file(DNAfold) and the PLOT file (UNAFold) are giving different replace.
Can you suggest why is this happening and secondaly which utility should I use from UNAFold package that replaces DNAFold.
Name: Mark Schultz
Email: mark.schultz@cdu.edu.au
URL: http://www.atrf.org.au/researchers.php/
Remote Host: 138.80.201.24
Subject: Thanks for Mfold
Hi Michael,
Thanks for writing the MFold program.
Best regards,
Mark
Name: Trina Norden-Krichmar
Email: tnordenk@ucsd.edu
URL: http://
Remote Host: 132.239.168.178
Subject: mfold output from UNAfold?
Hello,
I have been using mfold for about a year. Recently, I decided to switch over to UNAfold. The program seems to work fine, but it does not generate the same output files.
For example, the .gif files that were generated by mfold are not produced by any of the programs in UNAfold that I have tried. The only way that I was able to get a graphical output of a ssRNA was through the web interface program QuikFold. I did not find a copy of the Quikfold program in the download of UNAfold, so I was wondering if there was a way that I could get a copy??
Also, I like the standard output of mfold, which shows a text version of the structure with the nucleotides and their numbers in the sequence. Is there a way to get such output in any of the UNAfold programs?
Any information would be greatly appreciated!!
Thanks,
Trina
Name: Roland Gaboury
Email: rolandgaboury@gmail.com
URL: http://
Remote Host: h64-5-222-18.gtcust.grouptelecom.net
Subject: Greetings
Hi Michael. I figured you'd be wondering who that was that came by your site, so I figured I should leave a message. Not to mention, I'm MUCH closer to you now... I have relocated to the Maritimes and now have a house in Dartmouth, NS with my wife Isabelle. I'm working as a senior engineer for Brooke Ocean Technology, and my wife is a scientific programmer / modeller / acoustician at Jasco Research. At any rate, should you ever be inclined, give me a call at 902-446-5873, or if you're in the neighborhood, I'd be delighted to introduce you to Isabelle and have you over for dinner... possibly even paella... Cheers.
Roland
Name: Kyung Hyun Lee
Email: doccabi@kist.re.kr
URL: http://
Remote Host: 147.46.44.16
Subject:
Thanks!! M-fold server give me useful information for prediction of RNA secondary structure~ Thank you,sir~ Dr. Zuker!
Name: Marco Mangone
Email:
URL: http://
Remote Host:
Subject: installation problem
Dear Dr. Zuker,
I have the following problem with mfold:
when I type:
mfold SEQ=seq.fasta
I get
cat: /home/marco/mfold/unafold-3.3/data/begin.dat2: No such file or directory
REUSE= NO
auxgen failed
Job Aborted
the file seq.log (whis is created everytime I run mfold) reports:
auxgen: error while loading shared libraries: libg2c.so.0: cannot open shared ob
ject file: No such file or directory
do you have any clue what I am doing wrong ?
thanks,
Marco
Name: Elena Korchagina
Email: misterix@rambler.ru
URL: http://
Remote Host: vpn2-nat2.starlink.ru
Subject: Structure rotation does not work!
Structure rotation does not work! Please, make it work or instruct me what I may do wrong. Thank you.
M. Zuker replies: I think that you are wrong. I just checked, and structure rotation is working perfectly. It is working when the structure rotation option is chosen on the folding form and it is also working when structures are redrawn interactively.
I cannot help you unless you provide more details.
¤