Date: Mon Jan 24 23:02:05 EST 2005
Name: jiahai
Email:jwang@chem.ufl.edu URL:http://www.chem.ufl.edu/~jwang Remote Host: n128-227-139-33.xlate.ufl.edu
Subject: defect
the big thing , is the software can not caculate the binding parameter with one strand (hairpin) , another is linear.
Date: Mon Feb 14 16:24:17 EST 2005
Name: George Chaconas
Email:chaconas@ucalgary.ca URL:http:// Remote Host: pc82.oncology.ucalgary.ca
Subject: hybridization program
hi,have used the DNA folding program with success, but am unable to get an output from the DNA hybridization program using the same input sequence. is the program working? thanks Date: Wed Feb 16 18:09:47 EST 2005
Name: Mike
Email: URL:http://www.mikeskramstad.com/TI-86-programs/ Remote Host: dsl-201-137-192-233.prod-infinitum.com.mx
Subject: mfold
Thanks for the mfold software. It installed easily and works well.
Date: Thu Feb 24 16:01:53 EST 2005
Name: Aron Yoffe
Email:ayoffe@chem.ucla.edu URL:http:// Remote Host: d-128-97-138-40.chem.ucla.edu
Subject: compiling mfold-quik for Mac OSX
Dear Dr. Zuker:
Thank you for your suggestion last year that I use mfold-quik to fold numerous sequences
(this enables me to avoid the .jpg outputs, which slow down the computation
significantly). I've compiled both mfold and mfold-quik (from mfold-3.1-Mac-OSX)
on my Mac G5 (running OSX 10.3.8). They are running fine, except that while the
sequence size limit for mfold is 6000 bases (as it should be, since I set MAXN=6000 in the
makefiles), that for mfold-quik is only about 600 (I recall from when I compiled your
program on a Linux box I had a similar problem, except that the limit for mfold-quik was
slightly higher, about 800). I'd like to increase the size limit for mfold-quik to 6000. Is
there a modification I can add to "Makefile-Quikfold" that will accomplish this? Here's the
numbers from the current makefiles:
FROM MAKEFILE AND MAKEFILE-OSX:
MAXN2 = 500
MAXN = 6000
MAXN1 = 6000
FROM MAKEFILE-QUIKFOLD:
MAXN1 = 6000
MAXN2 = 600
[I tried adding the line "MAXN=6000" to Makefile-Quikfold, but that didn't help.]
Sincerely,
Aron Yoffe, Dept. of Chemistry, UCLA
M. Zuker replies:
Just change "MAXN2" to 6000 or to whatever other maximum sequence
size.
I feel obligated to point out that the mfold software is now mostly
obsolete. My student, Nick Markham, has created a software package for
hybridizing two strands of DNA or RNA. Our "working name" for this
package has been "HYBRID". Our focus has been on the accurate
prediction of entire melting profiles. Thus we predict heat capacity
(Cp) and UV absorbance at 260 nm as a function of
increasing temperature. We also compute mole fractions as a function
of temperature, although these are difficult to measure
experimentally.
Since we consider dimer formation in competition with folding, Nick
wrote folding software as well as hybridization software. Although we
compute equilibrium partition functions for the different molecular
species, testing of the new software required that Nick reproduce
minimum free energy folding as well. One thing led to another and over
the past year and a half, new and much better software was
created. Since our focus has been on shorter, rather than on longer
sequences, Nick did not bother to resort to a variety of tricks to
minimize memory usage. I'm not sure if his software is faster or
slower for minimum energy folding of 6000 bases, but it is a lot more
convenient to use. One feature not (yet) implemented is the folding of
circular RNA or DNA.
We have created a new web server dedicated to melting predictions for
pairs of oligos up to (at this time) 50 in length. See:
Nick has only very recently
created an export version of the underlying software. It is available
from this web site. Right now he calls it the "DINAMelt" software. I
want to use the more general name, "UNAFold", to describe the entire
package, with "DINAMelt" reserved for applications dedicated to
melting predictions. A sub-package named "OligoArrayAux" has been available from Nick's web
site for a while. It was assembled to go with the
"OligoArray" software for gene probe design on microarrays.
Right now, I would advise you to take a look at the "OligoArrayAux"
software. The "hybrid-ss-min" program computes minimum free energy
foldings for many sequences and over a range of different
temperatures, in a single run. The "-E" flag computes minimum energies
only.
Date: Mon Mar 14 11:31:07 EST 2005
Name: Jeremy Gore
Email:jeremy.gore@yale.edu URL:http:// Remote Host: dhcp128036104066.its.yale.edu
Subject: Predicting concentration using mfold
I'd like to be able to predict the relative concentrations of two classes of DNA structures
for the same sequence under physiological conditions. Specifically, the ratio between one
group of structures under one set of constraints, and another under a separate set. Is
there any way to do this with mfold/hybrid2? Vienna calculates something called the
ensemble entropy for a sequence with constraints in addition to the mfe structure - if I'm
not mistaken the difference between the two ensemble entropies can be used to calculate
Keq. Unfortunately Vienna doesn't come with a parameter file for DNA.
Date: Tue May 3 12:05:00 EDT 2005
Name: Dr. Harris
Email:popke001@umn.edu URL: Remote Host: 63.226.144.86
Subject: MFold
Thanks so very much. Mfold helped us design good PCR primers around a very tough secondary structure problem.
Date: Wed May 11 21:10:00 EDT 2005
Name: xnzhang
Email: URL: Remote Host: rrcs-24-227-238-8.sw.biz.rr.com
Subject: I like your new photo. better than your old one. Happy birthday to you :)
Date: Thu May 19 15:18:55 EDT 2005
Name: Email: URL: Remote Host: pcp04394857pcs.nrockv01.md.comcast.net
Subject: Mfold
The Mfold program has been very useful in my reaserch on carmoviruses.
Thank you for such a wonderful program, and PLEASE work on an RNA drawing program! Date: Sat May 21 02:15:49 EDT 2005
Name: carole
Email:purrfectbnb@webtv.net URL:http://www.purrfectbnb.com Remote Host: netcache-3002.bay.webtv.net
Subject: you
NICE photo.
It's 2:30 A.M., I can't sleep so I've been looking up things.
So HI!
Date: Wed Jun 15 06:09:30 EDT 2005
Name: kamna dubey
Email:dubey_kamna@rediffmail.com URL:http://www.chem.ufl.edu/~jwang Remote Host: 203.190.146.210
Subject: anticipatory
sir,
i m pursuing my engineers degree in biotechnology in INDIA. I wanna learn bout designing a protein structure,its handling analysis etc.i l ike 2 b a part of some presentation projects even competitions in dis field so plz gimme ur valuable guidance 4 the same.
i aim 2 giv my best in dis field so plz do the needful.
thanking u in anticipation,
urs
kamna dubey
lucknow,UP
INDIA Date: Wed Jun 15 16:35:22 EDT 2005
Name: Sanja Rogic
Email:rogic@cs.ubc.ca URL:http:// Remote Host: alimia.cs.ubc.ca
Subject: differences in number of suboptimals
Hi,
I am getting a different number of suboptimal structures when I run the web version and the command line version, which I downloaded from your site. In both cases I am using default parameters.
Do you know why is this happening?
I would like to run mfold locally but to obtain the same results as on your web server.
Thanks,
Sanja
M. Zuker replies:
When you run mfold locally, select the option 'RUN_TYPE=html' and you will get identical results as on the web server, assuming that you are using the same version of the software.
Date: Wed Jun 29 08:28:06 EDT 2005
Name: Email: URL:http:// Remote Host: gsv2.showa.gunma-u.ac.jp
Subject: hybridization server
Sir,I can use the mfold server, but I can't get an output from the hybridization server.Would you mind checking this? Thanks.
M. Zuker replies:
What do you mean by "the hybridization server"?
If you mean my old two-state server, then please read what I wrote below. This server has been fixed as of about 19:00 EDT on July 1. See also the related two-state web server that prints a hybridization.
The new DINAMelt hybridization web server is new. Nick Markham, the graduate student who created the software and the web site, uses a fork command to create a child process that is a copy of the parent cgi script. Once a satisfactory signal is returned from the child, the parent process points the browser to a temporary 'index.html' page that refreshes itself until replaced by the output of the child process. Then the parent dies. It's a robust and proper protocol. Unfortunately, it is failing about 15 to 20 percent of the time. We don't know why yet. When this happens, please just go back to the form and ressubmit your job. Please write to Nick if repeated attempts continue to fail. We are trying our best to correct the problem.
Date: Wed Jun 29 19:10:15 EDT 2005
Name: Vassilis
Email:v.sandalakis@uea.ac.uk URL:http:// Remote Host: pete-cache-6.server.ntli.net
Subject: No Output for RNA folding!
Sir,
i've been trying to use quickfold for some miRNA sequences,
but i can't get any output.I only get
Job aborted! No Structure!
you might want to check it out.
Thank you
Vassilis
M. Zuker replies:
This has not a good month for my web servers! We are about to update the operating system and web server protocols. The new DINAMelt web server (see above) is experiencing problems that seem tricky to fix. I just created version 3.2 of mfold and all the mfold related applications are now using this version. I broke many things with this transition. I was unaware of most of the problems until today, when a number of complaints came in. It was both simple and easy to fix the quikfold web server, the two-state hybridization server(s), the zipfold server and the Tm server. The overlay boxplot option on the main mfold server has been broken for a couple of weeks. My apologies to all. The new mfold applications will soon have the same URLs, but with the "old" removed.
Date: Fri Jul 1 05:05:50 EDT 2005
Name: Koussov
Email:koussov@molbio.uni-luebeck.de URL:http:// Remote Host: molbio.uni-luebeck.de
Subject: no result
Dear Sir/Madam,
I am trying to use 2-state hybridization program, enter either my two tested RNAs through semi-column as recommended or even your sample (copy-paste) and receive no result et all (document done 1.7 sec, that is all). How can I get the free energy of two RNAs hybridization (duplex formation).
Thanks
Yuri Kousov, Dr
M. Zuker replies:
So sorry. Please see what I wrote above. It's working now.
Date: Fri Jul 1 08:57:53 EDT 2005
Name: Calle
Email:callerubin@hotmail.com URL:http:// Remote Host: ckmf-66.ckmf.uu.se
Subject: No foldings possible
I am getting the same error
M. Zuker replies: As I wrote above, the mfold related web servers should be working now. If not, write again.
Date: Mon Jul 4 08:22:59 EDT 2005
Name: Susan Schönmann
Email:sschoenmann@botinst.unizh.ch URL:http:// Remote Host: 130.60.201.119
Subject: 2 state Hybridization server
Dear Sir,
I used the mfold 2 state hybridization server with success before, but unfortunately there are no outputs since several days (since today: page cannot be displayed error). Do you mind checking this ?
Does your new DINAMelt Server complete the same job using the same parameters ? I would like to calculate delta G from a duplex oligonucleotide (probe and target).
thanks for help
Sue
Date: Mon Jul 4 10:13:05 EDT 2005
Name: Vanessa
Email:vadaui@itg.be URL:http:// Remote Host: itg.customer.antwerpen.belnet.net
Subject: website
Dear Dr. Zucker,
I find your website very helpful in order to verify the folding of DNA and RNA.
I have noted that the links are missing and that the website is not functioning at all. Could you tell me please when it will be normal again?
I thank you very much.
Sincerely yours,
Vanessa Adaui
Date: Tue Jul 5 02:38:51 EDT 2005
Name: Susan
Email:sschoenmann@botinst.unizh.ch URL:http:// Remote Host: 130.60.201.119
Subject: bravo
Dear Sir,
Thank you for your rapid service ! what an accomplishment, the 2 state hybridization server is working again. A great tool for research!
yours sincerly
Susan
Date: Tue Jul 5 06:01:39 EDT 2005
Name: Yoshiharu Tokita
Email:ytokita@health.gunma-u.ac.jp URL:http:// Remote Host: gsv2.showa.gunma-u.ac.jp
Subject: I really appreciate it
Dear Sir,
At the beginning, I hope you will forgive me for impolite manner that I donft put down my name to this guestbook (Date: Wed Jun 29 08:28:06 EDT 2005).
As you have guessed, "the hybridization server", which I wrote before, mean two-state server. Today, I try to get two-state hybridization program, and I succeed in getting output. You've been very helpful.
In our laboratory, we often use your web site to verify DNA folding and melting temperature. For our research, your site is excellent tool!
I thank you very much.
At the beginning, I hope you will forgive me for impolite manner that I donft put down my name to this guestbook (Date: Wed Jun 29 08:28:06 EDT 2005).
As you have guessed, "the hybridization server", which I wrote before, mean two-state server. Today, I try to get two-state hybridization program, and I succeed in getting output. You've been very helpful.
In our laboratory, we often use your web site to verify DNA folding and melting temperature. For our research, your site is excellent tool!
I thank you very much.
Yours gratefully
Yoshiharu Tokita
Date: Sat Jul 9 13:21:26 EDT 2005
Name: Vladimir Sevin
Email: URL:http://www.screening-compounds.com Remote Host: 81.211.67.194
Subject: Hi all. Visit my web site about combinatorial chemistry Short review of methods, history and application of combinatorial chemistry.
Date: Sun Jul 17 12:30:58 EDT 2005
Name: Andre
Email:andre@yahoo.com URL:http://www.chemsynthesis.com Remote Host: 81.211.67.194
Subject: Advanced ChemSynthesis is a research and development chemical company that specializes in custom synthesis of organic compounds and projects involving contract researches. M. Zuker comments:
This and the previous message are very close to what I call spam. I'll leave them for now and invite comments from users of my web site.
Date: Sat Jul 23 21:18:23 EDT 2005
Name: Eneas Aguirre
Email:aguirre@science.uva.nl URL:http:// Remote Host: pc-ibed050.science.uva.nl
Subject: external loops and DNA secondary structure
Thank you for this very usefull program.
I am not familiar with nucleic acid folding, and there are many things I do not understand about the calculations that m-fold does. For example, I would like to understand why external loops stabilize the secondary structure of DNA.
(For example, why has GATCACTTTTTTGTGATC a less negative dG than TGATCACTTTTTTGTGATC at default settings?) M. Zuker replies: External loops are neutral. For algorithmic reasons, the favorable single base stacking free energy of the 5' T on the helix is assigned to the external loop in the second folding below. Similarly, the favorable free energy of the T·T mismatch stacking on the last base pair of the helix is assigned to the hairpin loop for algorithmic reasons. Both of these terminal free energies are the result of interactions with the helix.
dG = -3.3 dG = -3.9
TT T TT
GATCAC T GATCAC T
CTAGTG T CTAGTG T
TT - TT
I also would like to understand why the initiation and termination penalties are not applied to the helixes. In the thermodynamic details of the structures, the dG of the helixes seem to be only the sums of the contributions of the base-pairs according to their neigbors. M. Zuker replies: I don't understand. For folding, the hairpin loop free energy (from entropy loss) is equivalent to the "initiation" penalty used in the hybridization of two strands. What do you mean by "termination penalty"? I have never used this term and have never seen it used.
Thanks
Eneas Aguirre
Date: Thu Jul 28 02:09:46 EDT 2005
Name: ajish
Email:kumbax@yahoo.com URL:http:// Remote Host: adsl-65-71-126-59.dsl.hstntx.swbell.net
Subject: DNA secondary structure
Is it possible to predict the secondary structure for multiple inputs simultaneously? M. Zuker replies: Yes. Use the quikfold server.
Date: Sun Jul 31 12:11:38 EDT 2005
Name: Zhongkui Song
Email:songsir2003@yahoo.com.cn URL:http:// Remote Host: 163.com
Subject: perplexed questions
dear sir:
Despite based on the same RNA sequence,different results will be produced ,when using different mfold versions.Which result will be more reliable?
we find that extra base "C"will be added into predicted secondary structures using such sequences as " 5'- GGG......UAUAC-3'" under mfold version 3.0 (online web version).Would you like to explain this phenomenon for us all?
with best wishes.
Date: Sun Aug 7 09:44:11 EDT 2005
Name: João Paulo Oliveira
Email:jpo@med.up.pt URL:http:// Remote Host: bl5-217-154.dsl.telepac.pt
Subject: mRNA folding
Thanks for the help.
JPO-
Date: Thu Aug 18 05:24:50 EDT 2005
Name: I. TEO
Email:i.teo@imperial.ac.uk URL:http:// Remote Host: dd-sshaunak5.hh.med.ic.ac.uk
Subject:
Helped us explain some ropey real-time PCR results. Should have tried it first!
Date: Tue Aug 23 11:24:36 EDT 2005
Name: Kris Vandenreijt
Email:krisvandenreijt@hotmail.com URL:http:// Remote Host: webcache-kulnet-1.kuleuven.ac.be
Subject: Folding DNA
Dear Dr. Michal Zuker,
is there a way to present the secundary structure of DNA as double stranded DNA instead of single?
Thanks in advance!
Kind Regards
Kris Vandenreijt
Date: Thu Aug 25 16:24:14 EDT 2005
Name: Adrian
Email:plattsa@genetics.wayne.edu URL:http:// Remote Host: 146.9.110.50
Subject: I don't think I'm an automatic agent
Hi
I was able to use the mfold server last week, but this week I seem to only get the message below, am I skipping a checkbox somewhere? I'm submitting manually not automating the submission:
If you wish to hit the mfold server automatically, please
identify yourself. This means that you should include
RH='your host name'. For example, RH=www.primer.podunk.edu
/home/www/html/applications/mfold/old/mfold
16/05Aug25-16-21-32/1 M. Zuker replies: I have a single answer for this complaint and the following one. The error message is total nonsense. It was triggered because the server scratch disk was totally filled. I am posting this message a week after the problem was solved. Sorry for the inconvenience.
Date: Thu Aug 25 17:06:21 EDT 2005
Name: David McPheeters
Email:dsm10@po.cwru.edu URL:http:// Remote Host: hotmail.com
Subject: mfold problem
When I try to fold a sequence (an immediate job), I am getting the following message:
Content-type: text/plain If you wish to hit the mfold server automatically, please identify
yourself. This means that you should include RH='your host name'. For example,
RH=www.primer.podunk.edu /home/www/html/applications/mfold/old/mfold
17/05Aug25-17-05-56/1
Thanks !
Date: Sat Sep 3 11:16:58 EDT 2005
Name: Nike
Email:nikekelly@hotmail.com URL:http://phentermine5.host.sk Remote Host: 81.18.134.14
Subject: Phentermine
Well... congratulations to the webmaster! your site really rocks, bookmarked!
Date: Sun Sep 4 09:07:22 EDT 2005
Name: Tzahi Arazi
Email:tarazi@agri.gov.il URL:http:// Remote Host: i2-04.agri.gov.il
Subject: A program to calculate hyb energy of rna
I use your hyb server a lot. Do you know if their is a program that do the calculation and I can use to on my computer.
Sincerely
Tzahi
Date: Sun Sep 4 12:55:07 EDT 2005
Name: Zhang Chen
Email:zhangchn2004@gmail.com URL:http:// Remote Host: 202.113.19.233
Subject: A few questions about OligoArray 2 and mfold
Dear Prof. Zuker,
I read your paper about OligoArray 2 in PubMedCenter, and I was impressed by its designing. I downloaded from http://berry.engin.umich.edu/oligoarray2/OligoArray2.tar.gz. However, I was not able to get it run. Blastall seems to be all right, but I always get 2 kinds of errors from console:
From Mfold (foldSequence) java.lang.NullPointerException
From Mfold (constructor Mfold2 (String seqFile, double temperature, String directory)) java.io.IOException: java.io.IOException: Too many open files
And in the log file '0/OligoArray.log', there are lines of 'Mfold was dead but restarted' errors. And finally I have to quit manually, since it did not seem to stop. Before these errors, it gives out results such as
'before update thermodata
after update thermodata
before Mfold >AF070521141
GGCAGGAAGAAGCGGAGACAGCGACGAAGA'.
What can I do to make it work normally?
p.s.: I used the options '-n 10 -d refseq_rna -l 20 -L 30'. Date: Fri Sep 9 04:13:05 EDT 2005
Name: Yu Wang
Email:yu.wang at gsf.de URL:http://mips.gsf.de/staff/wang/index.html Remote Host: falanou.gsf.de
Subject: thank for help
Dear Prof. Zuker,
Thanks a lot for your quick reply concerning my installation problem at first and later for the sequence length problem. I am very grateful for all these. I believe that your kind help is a very important factor for which mfold software becomes so popular in our science community.
Best regards,
Yu
PS. just in case someone else will encounter the similar problem: the mfold software does not read more than 80 sequence characters per line.
Date: Tue Sep 27 17:01:29 EDT 2005
Name: Bill Bruno
Email:billb@lanl.gov URL:http:// Remote Host: vpn-client-39.lanl.gov
Subject: expiration times
Some structures I did yesterday "cannot be found" this morning,
so the 30 hr clock seems not to be accurate. It would be nice if one
could even extend the 30 hr clock by clicking once a day that I might
want to look at this one again tomorrow, since even if I download all
the structures there seems to be no way to upload them again to
get at all the nice viewing features.
PS: This site is great!
Date: Tue Sep 27 17:59:54 EDT 2005
Name: Bill Bruno
Email:billb@lanl.gov URL:http:// Remote Host: vpn-client-39.lanl.gov
Subject: one more thing
It would really make sense to me if one of the secondary structure output
formats were the same as constraint formats used by mfold and other
programs on your site!
Date: Sun Oct 2 01:11:52 EDT 2005
Name: Enoch
Email:enochctso@gmail.com URL:http:// Remote Host: ppp8-235.lns1.syd7.internode.on.net
Subject: Installing Mfold-3.2
Dear Professor Zuker,
I have been trying to install Mfold-3.2 onto my Ubuntu linux.
When it is completed, I tried to execute the sample folding but have experienced the following error:
---
enoch@ubuntu:~/ProgramFiles/Mfold-3.2/samples$ mfold SEQ=mdv1.seq ANN=p-num RUN_TYPE=html
cat: /dat/begin.dat: No such file or directory
REUSE= NO
cp: `mdv1.seq' and `./mdv1.seq' are the same file
mdv1.pnt created.
Sequence length is 221
Folding at 37 degrees using version 3.0 dat files.
Save file created using nafold2.
Save file is empty. No foldings.
Job Aborted
enoch@ubuntu:~/ProgramFiles/Mfold-3.2/samples$
---
Would you mind pointing out what I have done wrong? Perhaps in the installation??
Thanks very much.
Enoch M. Zuker replies: If you are getting the error message:
cat: /dat/begin.dat: No such file or directory
then you have not defined the environment variable, MFOLDDAT. The value of $MFOLDDAT should be the name of the directory where the mfold energy and related files are stored. If you do a "make install", this directory is what is called "DATDIR" in the makefile. If you do not bother to copy these files to another directory, then you can point to the "dat" subdirectory of where the mfold package resides. For example, in your case, it seems that
would work. You may define an environment variable, "MFOLD", instead. It points to the mfold program files. So you could defined MFOLD as (in your case) $HOME/ProgramFiles/Mfold-3.2. If the software cannot find the MFOLDDAT environment variable, it looks for the energy files in $MFOLD/dat. Environment variables are normally set in the .cshrc, .bash_profile (or similar) file. They can be set globally or just for individual users.
Date: Mon Oct 3 15:18:42 EDT 2005
Name: Trina
Email:tnordenk@ucsd.edu URL:http:// Remote Host: 132.239.168.175
Subject: length of sequence
Dear Dr. Zuker,
I have just started using mfold to analyze some data, and I have a question. I have a
bunch of sequences that are about 100 - 150 nucleotides in length. When I run them
through the mfold web interface (one at a time), they work fine and all the nucleotides are
used to calculate the results. However, when I run a sequence through mfold from a
command line on our installation here, it only uses the first 84 nucleotides. Similarly,
when I run a file containing all of my sequences through nafold, it just uses the first 84
nucleotides in each sequence. I looked at the mfold and nafold documentation, and I
can't see any mention of why it would just use 84, or how to configure it to use all the
nucleotides. I looked at my data files and I did not find any weird line-breaks. Do you
have any idea what is happening? Any information would be greatly appreciated!!
Thanks,
Trina M. Zuker replies:
It's time to fix this silly problem. The mfold web server is more "intelligent" than the existing stand alone package. If you have a local version of mfold, then it expects the sequence file to contain not more than 80 characters per line. Edit your sequence file and the problem should be solved. If not, write back.
January 16, 2006: I solved the long line problem and introduced another bug. This was corrected on December 10, 2005. You need a corrected version of the "reformat-seq.sh" script. Please refer to my reply to Agnieszka (Jan 5, 2006) below.
Date: Mon Oct 10 01:33:13 EDT 2005
Name: Ebenezer Tumban
Email:etumban@hotmail.com URL:http:// Remote Host: parvo.nmsu.edu
Subject: Structure orientation
Hi Dr. Zuker
Thank you for your execellent program for folding RNA. I have fused folded an RNA and used the constriants and all my bases are paired as I wanted. The problem I have is to orientate the stem loops with respect to others so that they can be like a similar sequence whose structure has been predicted. My folded Structure looks clustered and almost circular. Is there a way I can spread it out or change the orientation/distance of one stemp loop with respect to another? Thanks. M. Zuker replies:
Try using the "new" option for secondary structure display. You can plot clockwise or counterclockwise. More important, you can choose the "flat" or "flat alt" option for the exterior loop. See the supplementary material for my article on the mfold web server. Try the natural option. Most of all, experiment. Mix alternative options and see what works best for you. Large structures can be displayed in pieces.
Date: Sun Oct 23 07:25:53 EDT 2005
Name: Narsi
Email:ecacofonix@gmail.com URL:http://www.ebpo.in Remote Host: 61.17.179.8.static.vsnl.net.in
Subject: Good knowing you and your work
Dear professor,
It was great to go through your web site and also good knowing you and your work...I used to do a bit of research in what are called genetic algorithms and had in fact had the fortune of co-inventing a small modification to the existing algos about a decade back. Since then of course I have changed tracks and now claim to be a businessman...but seeing your combination of math & biology brought back memories...and thank you very much for the amazing amount of valuable links on your page
Cheers
Narsi
Date: Sun Oct 23 16:28:14 EDT 2005
Name: Becky
Email:rlb37@cornell.edu URL:http:// Remote Host: mbg236152146.calsnet.cornell.edu
Subject: help
I cannot remember how to view Tm, delta H, delta S with the website. How does one do this?
Date: Tue Oct 25 05:26:29 EDT 2005
Name: antoine
Email: URL:http:// Remote Host: etu.unige.ch
Subject: Thanks for this tool.
I love your website it is so kitsch !
Date: Thu Nov 3 10:18:50 EST 2005
Name: leila
Email:leila_benslimane URL:http:// Remote Host: 196.203.51.10
Subject: help me
what is the method used by mfold to find different loops and compute free energy of an rna secondary structure?
Date: Thu Nov 3 14:54:27 EST 2005
Name: Jonathan Foley
Email:jonefoley@gmail.com URL:http:// Remote Host: 169-229-7-53.sph.berkeley.edu
Subject: mfold RNAml and RNAMLVIEW error
When I try to open a mfold generated rnaml structure file with rnamlview I get the following error:
a base-pair with the base n4 at the 5' side for the helix n infinity 1 is not found in the base-pair list of your RnaML file M. Zuker replies:
Thank you for reporting this problem. I have been aware for a while that rnaml files were not being parsed properly by web browsers. I looked into the rnaml.dtd file at the University of Montreal and found an error in it. We are working to resolve the problem.
November 18, 2005: There is no error in the rnaml.dtd file. The rnaml files from my web site are properly formatted and are parsed correctly if renamed to have the suffix "xml". It's a matter of browser settings. This has nothing to do with your problem. It turns out that "rnamlview" is not intelligent enough to read our rnaml files that contain all of the necessary information. I will contact the author of the rnamlview program as well as the Major group at the University of Montreal. When we specify a helix, we do not specify the individual base pairs as well. They are implied by the helix. I will pursue this problem until it is resolved, but I cannot promise a quick solution.
Date: Wed Nov 23 15:31:14 EST 2005
Name: John B. Dame
Email:damej@mail.vetmed.ufl.edu URL:http://159.178.12.40 Remote Host: 159.178.12.40
Subject: Thanks
Thanks for making your RNA folding program freely available for others to use. This was the first time I have used your site, and I found it friendly and easy to use.
Date: Tue Nov 29 08:41:54 EST 2005
Name: Roman Mueller
Email:muellerr@medizin.ukl.uni-freiburg.de URL:http:// Remote Host: sun21.ukl.uni-freiburg.de
Subject: Vienna
Hi!
Is there any way of getting the ouptut of many sequences using quikfold in the vienna format, as you can with mfold?
thanks a lot
Roman M. Zuker replies:
Yes. It's easy and already done. I just needed someone to ask.
Date: Thu Dec 1 17:17:38 EST 2005
Name: Maria Abreu
Email:maria.abreu@crchul.ulaval.ca URL:http:// Remote Host: poste114-186.crchul.ulaval.ca
Subject: T-G pairing
Hello,
I use frequently your program for DNA folding. The last time in my secondary structure one of the pairs was a T-G, I would like to know how this is possible and if depending of the context of the base the program match T-G.
Thanks
Maria Teresa Abreu M. Zuker replies:
This is not the place to discuss T-G base pairs in depth. They exist and contribute to the thermoddynamic stability of a helix. There is clear evidence from NMR deduced 3D structures that hydrogen bonds form. I urge you to look at the RNA Basepair Isostericity web site. The descriptions carry over, more or less, to DNA. You should also look up references to publications of Hatim Allawi and John SantaLucia on G-T pairs (mismatches) and on all sorts of other mismatches.
Date: Fri Dec 9 04:50:15 EST 2005
Name: Agnieszka
Email:abstrakcjonistka@interia.pl URL:http:// Remote Host: idss-kd.cs.put.poznan.pl
Subject: mfold - problem with running under CygWin
Hi,
I installed mfold 3.2 under CygWin (Linux-like environment for Windows) and when I'm trying to run it it is always the same error: "auxgen failed. Job aborted". could you tell me how to solve it?
Date: Wed Jan 4 22:37:20 EST 2006
Name: Jing Zhang
Email:zhangjing@hrbeu.edu.cn URL:http:// Remote Host: 218.7.43.222
Subject: apply for postdoctor position
Can I apply for postdoctor in your place?
¤
Name: jiahai
Email: jwang@chem.ufl.edu
URL: http://www.chem.ufl.edu/~jwang
Remote Host: n128-227-139-33.xlate.ufl.edu
Subject: defect
the big thing , is the software can not caculate the binding parameter with one strand (hairpin) , another is linear.
Name: George Chaconas
Email: chaconas@ucalgary.ca
URL: http://
Remote Host: pc82.oncology.ucalgary.ca
Subject: hybridization program
hi,have used the DNA folding program with success, but am unable to get an output from the DNA hybridization program using the same input sequence. is the program working? thanks
Name: Mike
Email:
URL: http://www.mikeskramstad.com/TI-86-programs/
Remote Host: dsl-201-137-192-233.prod-infinitum.com.mx
Subject: mfold
Thanks for the mfold software. It installed easily and works well.
Name: Aron Yoffe
Email: ayoffe@chem.ucla.edu
URL: http://
Remote Host: d-128-97-138-40.chem.ucla.edu
Subject: compiling mfold-quik for Mac OSX
Dear Dr. Zuker:
Thank you for your suggestion last year that I use mfold-quik to fold numerous sequences
(this enables me to avoid the .jpg outputs, which slow down the computation
significantly). I've compiled both mfold and mfold-quik (from mfold-3.1-Mac-OSX)
on my Mac G5 (running OSX 10.3.8). They are running fine, except that while the
sequence size limit for mfold is 6000 bases (as it should be, since I set MAXN=6000 in the
makefiles), that for mfold-quik is only about 600 (I recall from when I compiled your
program on a Linux box I had a similar problem, except that the limit for mfold-quik was
slightly higher, about 800). I'd like to increase the size limit for mfold-quik to 6000. Is
there a modification I can add to "Makefile-Quikfold" that will accomplish this? Here's the
numbers from the current makefiles:
FROM MAKEFILE AND MAKEFILE-OSX:
MAXN2 = 500
MAXN = 6000
MAXN1 = 6000
FROM MAKEFILE-QUIKFOLD:
MAXN1 = 6000
MAXN2 = 600
[I tried adding the line "MAXN=6000" to Makefile-Quikfold, but that didn't help.]
Sincerely,
Aron Yoffe, Dept. of Chemistry, UCLA
M. Zuker replies: Just change "MAXN2" to 6000 or to whatever other maximum sequence size.
I feel obligated to point out that the mfold software is now mostly obsolete. My student, Nick Markham, has created a software package for hybridizing two strands of DNA or RNA. Our "working name" for this package has been "HYBRID". Our focus has been on the accurate prediction of entire melting profiles. Thus we predict heat capacity (Cp) and UV absorbance at 260 nm as a function of increasing temperature. We also compute mole fractions as a function of temperature, although these are difficult to measure experimentally.
Since we consider dimer formation in competition with folding, Nick wrote folding software as well as hybridization software. Although we compute equilibrium partition functions for the different molecular species, testing of the new software required that Nick reproduce minimum free energy folding as well. One thing led to another and over the past year and a half, new and much better software was created. Since our focus has been on shorter, rather than on longer sequences, Nick did not bother to resort to a variety of tricks to minimize memory usage. I'm not sure if his software is faster or slower for minimum energy folding of 6000 bases, but it is a lot more convenient to use. One feature not (yet) implemented is the folding of circular RNA or DNA.
We have created a new web server dedicated to melting predictions for pairs of oligos up to (at this time) 50 in length. See:
The DINAMelt Server.
Nick has only very recently created an export version of the underlying software. It is available from this web site. Right now he calls it the "DINAMelt" software. I want to use the more general name, "UNAFold", to describe the entire package, with "DINAMelt" reserved for applications dedicated to melting predictions. A sub-package named "OligoArrayAux" has been available from Nick's web site for a while. It was assembled to go with the "OligoArray" software for gene probe design on microarrays.
Right now, I would advise you to take a look at the "OligoArrayAux" software. The "hybrid-ss-min" program computes minimum free energy foldings for many sequences and over a range of different temperatures, in a single run. The "-E" flag computes minimum energies only.
Name: Jeremy Gore
Email: jeremy.gore@yale.edu
URL: http://
Remote Host: dhcp128036104066.its.yale.edu
Subject: Predicting concentration using mfold
I'd like to be able to predict the relative concentrations of two classes of DNA structures
for the same sequence under physiological conditions. Specifically, the ratio between one
group of structures under one set of constraints, and another under a separate set. Is
there any way to do this with mfold/hybrid2? Vienna calculates something called the
ensemble entropy for a sequence with constraints in addition to the mfe structure - if I'm
not mistaken the difference between the two ensemble entropies can be used to calculate
Keq. Unfortunately Vienna doesn't come with a parameter file for DNA.
Name: Dr. Harris
Email: popke001@umn.edu
URL:
Remote Host: 63.226.144.86
Subject: MFold
Thanks so very much. Mfold helped us design good PCR primers around a very tough secondary structure problem.
Name: xnzhang
Email:
URL:
Remote Host: rrcs-24-227-238-8.sw.biz.rr.com
Subject:
I like your new photo. better than your old one. Happy birthday to you :)
Name:
Email:
URL:
Remote Host: pcp04394857pcs.nrockv01.md.comcast.net
Subject: Mfold
The Mfold program has been very useful in my reaserch on carmoviruses.
Thank you for such a wonderful program, and PLEASE work on an RNA drawing program!
Name: carole
Email: purrfectbnb@webtv.net
URL: http://www.purrfectbnb.com
Remote Host: netcache-3002.bay.webtv.net
Subject: you
NICE photo.
It's 2:30 A.M., I can't sleep so I've been looking up things.
So HI!
Name: kamna dubey
Email: dubey_kamna@rediffmail.com
URL: http://www.chem.ufl.edu/~jwang
Remote Host: 203.190.146.210
Subject: anticipatory
sir,
i m pursuing my engineers degree in biotechnology in INDIA. I wanna learn bout designing a protein structure,its handling analysis etc.i l ike 2 b a part of some presentation projects even competitions in dis field so plz gimme ur valuable guidance 4 the same.
i aim 2 giv my best in dis field so plz do the needful.
thanking u in anticipation,
urs
kamna dubey
lucknow,UP
INDIA
Name: Sanja Rogic
Email: rogic@cs.ubc.ca
URL: http://
Remote Host: alimia.cs.ubc.ca
Subject: differences in number of suboptimals
Hi,
I am getting a different number of suboptimal structures when I run the web version and the command line version, which I downloaded from your site. In both cases I am using default parameters.
Do you know why is this happening?
I would like to run mfold locally but to obtain the same results as on your web server.
Thanks,
Sanja
M. Zuker replies: When you run mfold locally, select the option 'RUN_TYPE=html' and you will get identical results as on the web server, assuming that you are using the same version of the software.
Name:
Email:
URL: http://
Remote Host: gsv2.showa.gunma-u.ac.jp
Subject: hybridization server
Sir,I can use the mfold server, but I can't get an output from the hybridization server.Would you mind checking this? Thanks.
M. Zuker replies: What do you mean by "the hybridization server"?
If you mean my old two-state server, then please read what I wrote below. This server has been fixed as of about 19:00 EDT on July 1. See also the related two-state web server that prints a hybridization.
The new DINAMelt hybridization web server is new. Nick Markham, the graduate student who created the software and the web site, uses a fork command to create a child process that is a copy of the parent cgi script. Once a satisfactory signal is returned from the child, the parent process points the browser to a temporary 'index.html' page that refreshes itself until replaced by the output of the child process. Then the parent dies. It's a robust and proper protocol. Unfortunately, it is failing about 15 to 20 percent of the time. We don't know why yet. When this happens, please just go back to the form and ressubmit your job. Please write to Nick if repeated attempts continue to fail. We are trying our best to correct the problem.
Name: Vassilis
Email: v.sandalakis@uea.ac.uk
URL: http://
Remote Host: pete-cache-6.server.ntli.net
Subject: No Output for RNA folding!
Sir,
i've been trying to use quickfold for some miRNA sequences,
but i can't get any output.I only get
Job aborted! No Structure!
you might want to check it out.
Thank you
Vassilis
M. Zuker replies: This has not a good month for my web servers! We are about to update the operating system and web server protocols. The new DINAMelt web server (see above) is experiencing problems that seem tricky to fix. I just created version 3.2 of mfold and all the mfold related applications are now using this version. I broke many things with this transition. I was unaware of most of the problems until today, when a number of complaints came in. It was both simple and easy to fix the quikfold web server, the two-state hybridization server(s), the zipfold server and the Tm server. The overlay boxplot option on the main mfold server has been broken for a couple of weeks. My apologies to all. The new mfold applications will soon have the same URLs, but with the "old" removed.
Name: Koussov
Email: koussov@molbio.uni-luebeck.de
URL: http://
Remote Host: molbio.uni-luebeck.de
Subject: no result
Dear Sir/Madam,
I am trying to use 2-state hybridization program, enter either my two tested RNAs through semi-column as recommended or even your sample (copy-paste) and receive no result et all (document done 1.7 sec, that is all). How can I get the free energy of two RNAs hybridization (duplex formation).
Thanks
Yuri Kousov, Dr
M. Zuker replies: So sorry. Please see what I wrote above. It's working now.
Name: Calle
Email: callerubin@hotmail.com
URL: http://
Remote Host: ckmf-66.ckmf.uu.se
Subject: No foldings possible
I am getting the same error
M. Zuker replies: As I wrote above, the mfold related web servers should be working now. If not, write again.
Name: Susan Schönmann
Email: sschoenmann@botinst.unizh.ch
URL: http://
Remote Host: 130.60.201.119
Subject: 2 state Hybridization server
Dear Sir,
I used the mfold 2 state hybridization server with success before, but unfortunately there are no outputs since several days (since today: page cannot be displayed error). Do you mind checking this ?
Does your new DINAMelt Server complete the same job using the same parameters ? I would like to calculate delta G from a duplex oligonucleotide (probe and target).
thanks for help
Sue
Name: Vanessa
Email: vadaui@itg.be
URL: http://
Remote Host: itg.customer.antwerpen.belnet.net
Subject: website
Dear Dr. Zucker,
I find your website very helpful in order to verify the folding of DNA and RNA.
I have noted that the links are missing and that the website is not functioning at all. Could you tell me please when it will be normal again?
I thank you very much.
Sincerely yours,
Vanessa Adaui
Name: Susan
Email: sschoenmann@botinst.unizh.ch
URL: http://
Remote Host: 130.60.201.119
Subject: bravo
Dear Sir,
Thank you for your rapid service ! what an accomplishment, the 2 state hybridization server is working again. A great tool for research!
yours sincerly
Susan
Name: Yoshiharu Tokita
Email: ytokita@health.gunma-u.ac.jp
URL: http://
Remote Host: gsv2.showa.gunma-u.ac.jp
Subject: I really appreciate it
Dear Sir,
At the beginning, I hope you will forgive me for impolite manner that I donft put down my name to this guestbook (Date: Wed Jun 29 08:28:06 EDT 2005).
As you have guessed, "the hybridization server", which I wrote before, mean two-state server. Today, I try to get two-state hybridization program, and I succeed in getting output. You've been very helpful.
In our laboratory, we often use your web site to verify DNA folding and melting temperature. For our research, your site is excellent tool!
I thank you very much.
Yours gratefully
Yoshiharu Tokita
Name: Yoshiharu Tokita
Email: ytokita@health.gunma-u.ac.jp
URL: http://
Remote Host: gsv2.showa.gunma-u.ac.jp
Subject: I really appreciate it
Dear Sir,
At the beginning, I hope you will forgive me for impolite manner that I donft put down my name to this guestbook (Date: Wed Jun 29 08:28:06 EDT 2005).
As you have guessed, "the hybridization server", which I wrote before, mean two-state server. Today, I try to get two-state hybridization program, and I succeed in getting output. You've been very helpful.
In our laboratory, we often use your web site to verify DNA folding and melting temperature. For our research, your site is excellent tool!
I thank you very much.
Yours gratefully
Yoshiharu Tokita
Name: Vladimir Sevin
Email:
URL: http://www.screening-compounds.com
Remote Host: 81.211.67.194
Subject:
Hi all. Visit my web site about combinatorial chemistry Short review of methods, history and application of combinatorial chemistry.
Name: Andre
Email: andre@yahoo.com
URL: http://www.chemsynthesis.com
Remote Host: 81.211.67.194
Subject:
Advanced ChemSynthesis is a research and development chemical company that specializes in custom synthesis of organic compounds and projects involving contract researches.
M. Zuker comments: This and the previous message are very close to what I call spam. I'll leave them for now and invite comments from users of my web site.
Name: Eneas Aguirre
Email: aguirre@science.uva.nl
URL: http://
Remote Host: pc-ibed050.science.uva.nl
Subject: external loops and DNA secondary structure
Thank you for this very usefull program.
I am not familiar with nucleic acid folding, and there are many things I do not understand about the calculations that m-fold does. For example, I would like to understand why external loops stabilize the secondary structure of DNA.
(For example, why has GATCACTTTTTTGTGATC a less negative dG than TGATCACTTTTTTGTGATC at default settings?)
M. Zuker replies: External loops are neutral. For algorithmic reasons, the favorable single base stacking free energy of the 5' T on the helix is assigned to the external loop in the second folding below. Similarly, the favorable free energy of the T·T mismatch stacking on the last base pair of the helix is assigned to the hairpin loop for algorithmic reasons. Both of these terminal free energies are the result of interactions with the helix.
dG = -3.3 dG = -3.9 TT T TT GATCAC T GATCAC T CTAGTG T CTAGTG T TT - TTI also would like to understand why the initiation and termination penalties are not applied to the helixes. In the thermodynamic details of the structures, the dG of the helixes seem to be only the sums of the contributions of the base-pairs according to their neigbors.M. Zuker replies: I don't understand. For folding, the hairpin loop free energy (from entropy loss) is equivalent to the "initiation" penalty used in the hybridization of two strands. What do you mean by "termination penalty"? I have never used this term and have never seen it used.
Thanks
Eneas Aguirre
Name: ajish
Email: kumbax@yahoo.com
URL: http://
Remote Host: adsl-65-71-126-59.dsl.hstntx.swbell.net
Subject: DNA secondary structure
Is it possible to predict the secondary structure for multiple inputs simultaneously?
M. Zuker replies: Yes. Use the quikfold server.
Name: Zhongkui Song
Email: songsir2003@yahoo.com.cn
URL: http://
Remote Host: 163.com
Subject: perplexed questions
dear sir:
Despite based on the same RNA sequence,different results will be produced ,when using different mfold versions.Which result will be more reliable?
we find that extra base "C"will be added into predicted secondary structures using such sequences as " 5'- GGG......UAUAC-3'" under mfold version 3.0 (online web version).Would you like to explain this phenomenon for us all?
with best wishes.
Name: João Paulo Oliveira
Email: jpo@med.up.pt
URL: http://
Remote Host: bl5-217-154.dsl.telepac.pt
Subject: mRNA folding
Thanks for the help.
JPO-
Name: I. TEO
Email: i.teo@imperial.ac.uk
URL: http://
Remote Host: dd-sshaunak5.hh.med.ic.ac.uk
Subject:
Helped us explain some ropey real-time PCR results. Should have tried it first!
Name: Kris Vandenreijt
Email: krisvandenreijt@hotmail.com
URL: http://
Remote Host: webcache-kulnet-1.kuleuven.ac.be
Subject: Folding DNA
Dear Dr. Michal Zuker,
is there a way to present the secundary structure of DNA as double stranded DNA instead of single?
Thanks in advance!
Kind Regards
Kris Vandenreijt
Name: Adrian
Email: plattsa@genetics.wayne.edu
URL: http://
Remote Host: 146.9.110.50
Subject: I don't think I'm an automatic agent
Hi
I was able to use the mfold server last week, but this week I seem to only get the message below, am I skipping a checkbox somewhere? I'm submitting manually not automating the submission:
If you wish to hit the mfold server automatically, please
identify yourself. This means that you should include
RH='your host name'. For example, RH=www.primer.podunk.edu
/home/www/html/applications/mfold/old/mfold
16/05Aug25-16-21-32/1
M. Zuker replies: I have a single answer for this complaint and the following one. The error message is total nonsense. It was triggered because the server scratch disk was totally filled. I am posting this message a week after the problem was solved. Sorry for the inconvenience.
Name: David McPheeters
Email: dsm10@po.cwru.edu
URL: http://
Remote Host: hotmail.com
Subject: mfold problem
When I try to fold a sequence (an immediate job), I am getting the following message:
Content-type: text/plain If you wish to hit the mfold server automatically, please identify
yourself. This means that you should include RH='your host name'. For example,
RH=www.primer.podunk.edu /home/www/html/applications/mfold/old/mfold
17/05Aug25-17-05-56/1
Thanks !
Name: Nike
Email: nikekelly@hotmail.com
URL: http://phentermine5.host.sk
Remote Host: 81.18.134.14
Subject: Phentermine
Well... congratulations to the webmaster! your site really rocks, bookmarked!
Name: Tzahi Arazi
Email: tarazi@agri.gov.il
URL: http://
Remote Host: i2-04.agri.gov.il
Subject: A program to calculate hyb energy of rna
I use your hyb server a lot. Do you know if their is a program that do the calculation and I can use to on my computer.
Sincerely
Tzahi
Name: Zhang Chen
Email: zhangchn2004@gmail.com
URL: http://
Remote Host: 202.113.19.233
Subject: A few questions about OligoArray 2 and mfold
Dear Prof. Zuker,
I read your paper about OligoArray 2 in PubMedCenter, and I was impressed by its designing. I downloaded from http://berry.engin.umich.edu/oligoarray2/OligoArray2.tar.gz. However, I was not able to get it run. Blastall seems to be all right, but I always get 2 kinds of errors from console:
From Mfold (foldSequence) java.lang.NullPointerException
From Mfold (constructor Mfold2 (String seqFile, double temperature, String directory)) java.io.IOException: java.io.IOException: Too many open files
And in the log file '0/OligoArray.log', there are lines of 'Mfold was dead but restarted' errors. And finally I have to quit manually, since it did not seem to stop. Before these errors, it gives out results such as
'before update thermodata
after update thermodata
before Mfold >AF070521141
GGCAGGAAGAAGCGGAGACAGCGACGAAGA'.
What can I do to make it work normally?
p.s.: I used the options '-n 10 -d refseq_rna -l 20 -L 30'.
Name: Yu Wang
Email: yu.wang at gsf.de
URL: http://mips.gsf.de/staff/wang/index.html
Remote Host: falanou.gsf.de
Subject: thank for help
Dear Prof. Zuker,
Thanks a lot for your quick reply concerning my installation problem at first and later for the sequence length problem. I am very grateful for all these. I believe that your kind help is a very important factor for which mfold software becomes so popular in our science community.
Best regards,
Yu
PS. just in case someone else will encounter the similar problem: the mfold software does not read more than 80 sequence characters per line.
Name: Bill Bruno
Email: billb@lanl.gov
URL: http://
Remote Host: vpn-client-39.lanl.gov
Subject: expiration times
Some structures I did yesterday "cannot be found" this morning,
so the 30 hr clock seems not to be accurate. It would be nice if one
could even extend the 30 hr clock by clicking once a day that I might
want to look at this one again tomorrow, since even if I download all
the structures there seems to be no way to upload them again to
get at all the nice viewing features.
PS: This site is great!
Name: Bill Bruno
Email: billb@lanl.gov
URL: http://
Remote Host: vpn-client-39.lanl.gov
Subject: one more thing
It would really make sense to me if one of the secondary structure output
formats were the same as constraint formats used by mfold and other
programs on your site!
Name: Enoch
Email: enochctso@gmail.com
URL: http://
Remote Host: ppp8-235.lns1.syd7.internode.on.net
Subject: Installing Mfold-3.2
Dear Professor Zuker,
I have been trying to install Mfold-3.2 onto my Ubuntu linux.
When it is completed, I tried to execute the sample folding but have experienced the following error:
---
enoch@ubuntu:~/ProgramFiles/Mfold-3.2/samples$ mfold SEQ=mdv1.seq ANN=p-num RUN_TYPE=html
cat: /dat/begin.dat: No such file or directory
REUSE= NO
cp: `mdv1.seq' and `./mdv1.seq' are the same file
mdv1.pnt created.
Sequence length is 221
Folding at 37 degrees using version 3.0 dat files.
Save file created using nafold2.
Save file is empty. No foldings.
Job Aborted
enoch@ubuntu:~/ProgramFiles/Mfold-3.2/samples$
---
Would you mind pointing out what I have done wrong? Perhaps in the installation??
Thanks very much.
Enoch
M. Zuker replies: If you are getting the error message:
cat: /dat/begin.dat: No such file or directory
then you have not defined the environment variable, MFOLDDAT. The value of $MFOLDDAT should be the name of the directory where the mfold energy and related files are stored. If you do a "make install", this directory is what is called "DATDIR" in the makefile. If you do not bother to copy these files to another directory, then you can point to the "dat" subdirectory of where the mfold package resides. For example, in your case, it seems that
export MFOLDDAT="$HOME/ProgramFiles/Mfold-3.2/dat"
would work. You may define an environment variable, "MFOLD", instead. It points to the mfold program files. So you could defined MFOLD as (in your case) $HOME/ProgramFiles/Mfold-3.2. If the software cannot find the MFOLDDAT environment variable, it looks for the energy files in $MFOLD/dat. Environment variables are normally set in the .cshrc, .bash_profile (or similar) file. They can be set globally or just for individual users.
Name: Trina
Email: tnordenk@ucsd.edu
URL: http://
Remote Host: 132.239.168.175
Subject: length of sequence
Dear Dr. Zuker,
I have just started using mfold to analyze some data, and I have a question. I have a
bunch of sequences that are about 100 - 150 nucleotides in length. When I run them
through the mfold web interface (one at a time), they work fine and all the nucleotides are
used to calculate the results. However, when I run a sequence through mfold from a
command line on our installation here, it only uses the first 84 nucleotides. Similarly,
when I run a file containing all of my sequences through nafold, it just uses the first 84
nucleotides in each sequence. I looked at the mfold and nafold documentation, and I
can't see any mention of why it would just use 84, or how to configure it to use all the
nucleotides. I looked at my data files and I did not find any weird line-breaks. Do you
have any idea what is happening? Any information would be greatly appreciated!!
Thanks,
Trina
M. Zuker replies: It's time to fix this silly problem. The mfold web server is more "intelligent" than the existing stand alone package. If you have a local version of mfold, then it expects the sequence file to contain not more than 80 characters per line. Edit your sequence file and the problem should be solved. If not, write back.
January 16, 2006: I solved the long line problem and introduced another bug. This was corrected on December 10, 2005. You need a corrected version of the "reformat-seq.sh" script. Please refer to my reply to Agnieszka (Jan 5, 2006) below.
Name: Ebenezer Tumban
Email: etumban@hotmail.com
URL: http://
Remote Host: parvo.nmsu.edu
Subject: Structure orientation
Hi Dr. Zuker
Thank you for your execellent program for folding RNA. I have fused folded an RNA and used the constriants and all my bases are paired as I wanted. The problem I have is to orientate the stem loops with respect to others so that they can be like a similar sequence whose structure has been predicted. My folded Structure looks clustered and almost circular. Is there a way I can spread it out or change the orientation/distance of one stemp loop with respect to another? Thanks.
M. Zuker replies: Try using the "new" option for secondary structure display. You can plot clockwise or counterclockwise. More important, you can choose the "flat" or "flat alt" option for the exterior loop. See the supplementary material for my article on the mfold web server. Try the natural option. Most of all, experiment. Mix alternative options and see what works best for you. Large structures can be displayed in pieces.
Name: Narsi
Email: ecacofonix@gmail.com
URL: http://www.ebpo.in
Remote Host: 61.17.179.8.static.vsnl.net.in
Subject: Good knowing you and your work
Dear professor,
It was great to go through your web site and also good knowing you and your work...I used to do a bit of research in what are called genetic algorithms and had in fact had the fortune of co-inventing a small modification to the existing algos about a decade back. Since then of course I have changed tracks and now claim to be a businessman...but seeing your combination of math & biology brought back memories...and thank you very much for the amazing amount of valuable links on your page
Cheers
Narsi
Name: Becky
Email: rlb37@cornell.edu
URL: http://
Remote Host: mbg236152146.calsnet.cornell.edu
Subject: help
I cannot remember how to view Tm, delta H, delta S with the website. How does one do this?
Name: antoine
Email:
URL: http://
Remote Host: etu.unige.ch
Subject:
Thanks for this tool.
I love your website it is so kitsch !
Name: leila
Email: leila_benslimane
URL: http://
Remote Host: 196.203.51.10
Subject: help me
what is the method used by mfold to find different loops and compute free energy of an rna secondary structure?
Name: Jonathan Foley
Email: jonefoley@gmail.com
URL: http://
Remote Host: 169-229-7-53.sph.berkeley.edu
Subject: mfold RNAml and RNAMLVIEW error
When I try to open a mfold generated rnaml structure file with rnamlview I get the following error:
a base-pair with the base n4 at the 5' side for the helix n infinity 1 is not found in the base-pair list of your RnaML file
M. Zuker replies: Thank you for reporting this problem. I have been aware for a while that rnaml files were not being parsed properly by web browsers. I looked into the rnaml.dtd file at the University of Montreal and found an error in it. We are working to resolve the problem.
November 18, 2005: There is no error in the rnaml.dtd file. The rnaml files from my web site are properly formatted and are parsed correctly if renamed to have the suffix "xml". It's a matter of browser settings. This has nothing to do with your problem. It turns out that "rnamlview" is not intelligent enough to read our rnaml files that contain all of the necessary information. I will contact the author of the rnamlview program as well as the Major group at the University of Montreal. When we specify a helix, we do not specify the individual base pairs as well. They are implied by the helix. I will pursue this problem until it is resolved, but I cannot promise a quick solution.
Name: John B. Dame
Email: damej@mail.vetmed.ufl.edu
URL: http://159.178.12.40
Remote Host: 159.178.12.40
Subject: Thanks
Thanks for making your RNA folding program freely available for others to use. This was the first time I have used your site, and I found it friendly and easy to use.
Name: Roman Mueller
Email: muellerr@medizin.ukl.uni-freiburg.de
URL: http://
Remote Host: sun21.ukl.uni-freiburg.de
Subject: Vienna
Hi!
Is there any way of getting the ouptut of many sequences using quikfold in the vienna format, as you can with mfold?
thanks a lot
Roman
M. Zuker replies: Yes. It's easy and already done. I just needed someone to ask.
Name: Maria Abreu
Email: maria.abreu@crchul.ulaval.ca
URL: http://
Remote Host: poste114-186.crchul.ulaval.ca
Subject: T-G pairing
Hello,
I use frequently your program for DNA folding. The last time in my secondary structure one of the pairs was a T-G, I would like to know how this is possible and if depending of the context of the base the program match T-G.
Thanks
Maria Teresa Abreu
M. Zuker replies: This is not the place to discuss T-G base pairs in depth. They exist and contribute to the thermoddynamic stability of a helix. There is clear evidence from NMR deduced 3D structures that hydrogen bonds form. I urge you to look at the RNA Basepair Isostericity web site. The descriptions carry over, more or less, to DNA. You should also look up references to publications of Hatim Allawi and John SantaLucia on G-T pairs (mismatches) and on all sorts of other mismatches.
Name: Agnieszka
Email: abstrakcjonistka@interia.pl
URL: http://
Remote Host: idss-kd.cs.put.poznan.pl
Subject: mfold - problem with running under CygWin
Hi,
I installed mfold 3.2 under CygWin (Linux-like environment for Windows) and when I'm trying to run it it is always the same error: "auxgen failed. Job aborted". could you tell me how to solve it?
Name: Jing Zhang
Email: zhangjing@hrbeu.edu.cn
URL: http://
Remote Host: 218.7.43.222
Subject: apply for postdoctor position
Can I apply for postdoctor in your place?
¤